Feeds
답변 있음
Decoding DNA sequence into binary
You can use str = ('TGACTCAGTCGTTCAATCTATGCC'); [~,~,ind] = unique(double(str)-65); dec2bin(ind-1)
Decoding DNA sequence into binary
You can use str = ('TGACTCAGTCGTTCAATCTATGCC'); [~,~,ind] = unique(double(str)-65); dec2bin(ind-1)
10년 초과 전 | 0
답변 있음
List toolboxes currently in use by session
The function ver will give you this information
List toolboxes currently in use by session
The function ver will give you this information
10년 초과 전 | 0
답변 있음
plotting general form of function
You can plot a symbolic expression with ezplot(sym_fun)
plotting general form of function
You can plot a symbolic expression with ezplot(sym_fun)
10년 초과 전 | 0
| 수락됨
