Feeds
답변 있음
Decoding DNA sequence into binary
You can use str = ('TGACTCAGTCGTTCAATCTATGCC'); [~,~,ind] = unique(double(str)-65); dec2bin(ind-1)
Decoding DNA sequence into binary
You can use str = ('TGACTCAGTCGTTCAATCTATGCC'); [~,~,ind] = unique(double(str)-65); dec2bin(ind-1)
거의 9년 전 | 0
답변 있음
List toolboxes currently in use by session
The function ver will give you this information
List toolboxes currently in use by session
The function ver will give you this information
거의 9년 전 | 0
답변 있음
plotting general form of function
You can plot a symbolic expression with ezplot(sym_fun)
plotting general form of function
You can plot a symbolic expression with ezplot(sym_fun)
거의 9년 전 | 0
| 수락됨