Decoding DNA sequence into binary
조회 수: 39 (최근 30일)
이전 댓글 표시
I have a sequence TGACTCAGTCGTTCAATCTATGCC, how to write code in matlab to convert it into binary? Please help me..Thank you
댓글 수: 3
Dabba Do
2018년 2월 14일
편집: Dabba Do
2018년 2월 14일
IF: every A matches to a T, THEN: the output for an A or a T is the same. The same is true of G and C they are a pair. So there are only two pairs, why not try defining each pair as a 1 or a 0. So if A and T = 1 and G and C = 0 then: the sequence TGACTCAGTGTTCAATCTATGCC would be: 101010101001101110111000. By coding each codon with a 1 and a 0 you are going to con-volute the Bits in your code and they work as pairs representing a single genetic Bit.
채택된 답변
James Tursa
2015년 9월 23일
편집: James Tursa
2015년 9월 23일
One way:
s = 'TGACTCAGTCGTTCAATCTATGCC'; % Input DNA string
[~,x] = ismember(s,'ATGC'); % Convert the ATGC into indexes
c = {'00','01','10','11'}; % Numeric strings to convert the indexes into
result = cell2mat(c(x)); % Convert the indexes into the numeric strings
추가 답변 (4개)
Bastien Chardonnens
2015년 9월 23일
You can use
str = ('TGACTCAGTCGTTCAATCTATGCC');
[~,~,ind] = unique(double(str)-65);
dec2bin(ind-1)
댓글 수: 0
Suresma Jena
2017년 8월 27일
i want to how to convert a DNA sequence into binary. ex- if x = ATGCAT then its binary sequence will be xA = 100010 xT = 010001 xG = 001000 xC = 000100
댓글 수: 6
lakshmi boddu
2018년 4월 8일
A pseudo random binary sequence of size 256 * 256 is generated with two 1 D logistic maps , from which 3-bit disjoint and consecutive binary sequences are extracted to choose DNA coding rule, as follows 000 ( 00-A,01-C 10-G,11-T) 001(00-A,01-G,10-C,11-T) 010(00-C,01-A,10-T,11-G) 011( 00-C ,01-T,10-A,11-G) 100( 00-G, 01-A,10-T,11-C) 101(00-G,01-T,10-A, 11-C) 110(00-T,01-C,10-G,11-A) 111( 00-T,01-G,10-C,11-A) . please help me sir how to implement in matlab
Siyab Khan
2019년 1월 15일
편집: Siyab Khan
2019년 1월 15일
Please also write code for DNA sequencig in 4 bits
via this given schema
4 2 1 0
N = 0 0 0 1 N represents the gap in DNA sequence
A = 0 1 0 0
T = 1 0 0 0
C = 0 0 1 0
G = 0 1 1 0
댓글 수: 0
Khaled belkacemi
2022년 4월 4일
편집: Khaled belkacemi
2022년 4월 4일
Hello,can someone help me to do the code for this situation? example of input data:0121212002202021101110002
and i want to code my data as this array ![](https://www.mathworks.com/matlabcentral/answers/uploaded_files/952024/image.jpeg)
![](https://www.mathworks.com/matlabcentral/answers/uploaded_files/952024/image.jpeg)
댓글 수: 0
참고 항목
카테고리
Help Center 및 File Exchange에서 Genomics and Next Generation Sequencing에 대해 자세히 알아보기
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!