Community Profile

photo

Sulaymon Eshkabilov


Last seen: Today 2019년부터 활동

research interests: vibrations, optimal control, system modeling and simulation, mechatronics... coding

Statistics

All
  • MATLAB Mini Hack Participant
  • MATLAB Central Treasure Hunt Finisher
  • Guiding Light
  • Revival Level 4
  • Commenter
  • Speed Demon
  • Draw Letters
  • Thankful Level 5
  • Leader
  • CUP Challenge Master
  • Knowledgeable Level 5
  • 12 Month Streak

배지 보기

Content Feed

보기 기준

답변 있음
Matlab Simulink Arduino package
You would need MATLAB Support Package for Arduino Hardware - see Arduino Support from MATLAB - Hardware Support - MATLAB & Simul...

3일 전 | 0

답변 있음
How to code equation
A couple of small errors have been corrected: m = 10e-3; a = 0.05; c = 0.1; x = @(t)(m/a)*exp(-(c/a)*t); t = linspace(0,1...

3일 전 | 0

| 수락됨

답변 있음
Calculate Wavelength from velocity FFT
the Matlab fcn fft() computes the complex valued discrete Fourier Transform values. Thus, there is an error in your code. To ob...

3일 전 | 0

답변 있음
how to solve this error?
Here is completely fixed code. There were several errors with inconsistent variable names, setting and solving symbolic equation...

3일 전 | 0

답변 있음
How to pull values from a variable to set as a new variable/column
If understood your question correctly, to read this data file and sort out its content, readtable() would be a good strating poi...

4일 전 | 0

답변 있음
Why is the FOR loop in my program producing empty matrices?
Here is a bit edited and revised version of your code: Ne=8; Ni=2; re=rand(Ne,1); ri=rand(Ni,1); a=[0.02*ones(Ne,1); 0.02+0.0...

4일 전 | 0

답변 있음
Plot a sinusoidal signal from an x(t) equation
You need to plot this exercise this way: Ts = 1/8; %seconds t = 0:Ts:1; x = @(t) cos(2*pi*t-(pi/2)); XX=x(t); plot(t, XX, ...

4일 전 | 0

| 수락됨

답변 있음
How do I let the user enter an equation that is then able to be used in abs() calcualtions
Use this small change by specifying the input argument (x) in your code: x = 0:0.001:1; fprintf(1,'For example: cos(x)\n'); ...

4일 전 | 1

| 수락됨

답변 있음
Keep Simulink Data Inspector plot settings between simulation runs
You should try to run this: Simulink.sdi.clearPreferences to get back to the default settings of Simulink. See help doc here...

4일 전 | 0

답변 있음
Finding the maximum value in a single
Here is how you can get max values from 1-by-n-by-3 array from each channel exaplined with a simple example: PP(:,:,1) = round(...

5일 전 | 0

답변 있음
How to change the colorbar limits in Matlab?
clim does the job, e.g.: surf(peaks) clim([1.2 2.6]) colorbar

5일 전 | 0

답변 있음
Change values in vectors
V=[1,2,3,4,5,6] IDX = find(V>3); V(IDX)=2 %% ALT. Way: V=[1,2,3,4,5,6] V(V>3)=2

6일 전 | 0

답변 있음
how does zoomplot work?
1st of all zoomPlot() is a 3rd party function and is not part of MATLAB 2022b package or its toolboxes. Therefore, to see what c...

6일 전 | 0

| 수락됨

답변 있음
Limit of Decreasing Plot Size in MATLAB
You should try these options with 'units', 'pixels': set(gcf,'units', 'pixels','position', [700, 700, 50, 50])

6일 전 | 0

답변 있음
How to Extract X,Y,Z vectors from grid data?
If you data as given n-by-5, then you can just use surf(z), e.g.: data = rand(5,50); surf(data)

6일 전 | 0

답변 있음
%() Error: Illegal use of reserved keyword "end".
Here is the corrected part of your code: ... for ID_realz = 1:N rng('shuffle'); Mult_noise = (sigma*randn(size(I...

7일 전 | 0

답변 있음
I get an error that does not match the number of rows and columns in the program.
There were over dozens of size related errors, figure handle and uncommented comments in your code that are fixed. The main func...

7일 전 | 1

| 수락됨

답변 있음
Interpolating numerical function of many variables
You should consider here some sort of unit compatibe value for U, S, D, V. In other words, 100% (and 80%, 60%, 40%, 20%) open U ...

7일 전 | 0

답변 있음
My code does not work
Note also that there is one more undefined input vars in your function call. v_e is undefined, v_idex is computed from the given...

7일 전 | 0

답변 있음
for loop to read different files
There are a few different ways that can do this exercise. Here is one of them: clearvars FILE = fullfile('C:\Users\...', '*.tx...

7일 전 | 1

답변 있음
Plotting data from struct array
Here is one simple example: t1 = linspace(-pi, pi, 200); t2 = linspace(-pi, pi, 500); f1 = 2*sin(t1); f2 = 3*cos(t1); f3 ...

7일 전 | 0

답변 있음
How can I change the font size of the current axis?
There is one minor correction with one of the otptions proposed by @Mat Fig using fontsize() the unit has to be specified: x = ...

7일 전 | 0

답변 있음
How do I take my generated string outputs from for loop and return a list?
Here si the solution: a=[]; seq = 'ACAUUUGCUUCUGACACAACUGUGUUCACUAGCAACCUCAAACAGACA' for i=1:3:numel(seq)-2 a = [a; (se...

9일 전 | 0

답변 있음
How to replace the values of a vector from desired location to its end?
The err in your code is with 0 in b's index that is not acceptable. Because b(0) does not exist. Which element of b vector are y...

12일 전 | 0

답변 있음
how to optimize a sweep for solving inequalities?
One of the possible ways to speed up your code is to get rid of display of resuts. Instead storing them, e.g.: syms ki kd i0 ...

12일 전 | 0

답변 있음
Solve a nonlinear function with one variable
It is quite simple to solve this exercise. Just use vpasolve(), e.g.: syms x Solution = vpasolve(x-x^2+2*sin(x)*(x-1)==0) An ...

12일 전 | 1

답변 있음
How do I remove the Ans from the result
You'd need to use either display or fprintf not to have ans, e.g.: %% fprintf if Alpha(1,1) == 1 fprintf('Ok \n') else Al...

12일 전 | 0

답변 있음
Error using logical operators on a string input
Here is the corrected part of your code. Note that you'd need to get a single value logical in order to compare the two differe...

12일 전 | 0

답변 있음
When I use vpasolve I get all variables as [0x1 sym], any input as to what the problem might be would be appreciated!
The problem here is that you have defined 4 equations and trying to solve for 5 unknowns (beta1, beta2 beta3 M2, M3) that is inc...

12일 전 | 0

| 수락됨

답변 있음
Solve a multiobjective optimization problem by problem-based approach in Matlab2021a
It is working ok: % teste_multiobjective file x1 = optimvar('x1','LowerBound',0); x2 = optimvar('x2','LowerBound',0); s1 = 5...

12일 전 | 0

더 보기