Window length Selection size for DNA sequence?
조회 수: 1 (최근 30일)
이전 댓글 표시
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code
댓글 수: 0
답변 (0개)
참고 항목
카테고리
Help Center 및 File Exchange에서 Genomics and Next Generation Sequencing에 대해 자세히 알아보기
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!