Window length Selection size for DNA sequence?
이전 댓글 표시
i have a DNA sequence like
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code
답변 (0개)
카테고리
도움말 센터 및 File Exchange에서 Genomics and Next Generation Sequencing에 대해 자세히 알아보기
2019년 1월 28일
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!
Translated by 
