Feeds
질문
how to find accuracy from confusion matrix having 4 x4 dimensions
I have used the following function for finding confusion matrix c=confusionmat(x,y) it gives me output like that , C = ...
거의 7년 전 | 답변 수: 0 | 0
0
답변질문
Pleas tell me how to solve the Error in the Code?
this given below is the code if Interior Search Algorith with Back propagation i want results like this Epoch=1 Time=1.40838 ...
거의 7년 전 | 답변 수: 0 | 0
0
답변질문
Window length Selection size for DNA sequence?
i have a DNA sequence like ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 s...
대략 7년 전 | 답변 수: 0 | 0
0
답변답변 있음
How to decide window size for a moving average filter?
How can we select a wind size for the selection of DNA sequence like ATCGGGCTTACGG window length size 5 to read the sequence...
How to decide window size for a moving average filter?
How can we select a wind size for the selection of DNA sequence like ATCGGGCTTACGG window length size 5 to read the sequence...
대략 7년 전 | 0
답변 있음
Decoding DNA sequence into binary
Please also write code for DNA sequencig in 4 bits via this given schema 4 2 1 0 N = 0 0 0 1 N repre...
Decoding DNA sequence into binary
Please also write code for DNA sequencig in 4 bits via this given schema 4 2 1 0 N = 0 0 0 1 N repre...
대략 7년 전 | 0
