Feeds
질문
Help me understand code to draw the nullclines
The code can be found here: <https://www.math.uwaterloo.ca/~bingalls/MMSB/Code/matlab/symmetric_network.m>
대략 8년 전 | 답변 수: 0 | 0
0
답변질문
Matlab index in range yet I get out of range
I'm trying to extract the model parameters using: clc clear all data = xlsread('cancer_train.xlsx'); X = data(...
8년 초과 전 | 답변 수: 1 | 0
1
답변질문
Function handle is giving wrong results!
This code is clearly giving wrong results: clc;clear all a0 = 2; a1 = 2; y = [1 1.4 2.3]; x = [1 2 3]; f = @...
거의 9년 전 | 답변 수: 2 | 0
2
답변질문
How to draw a log function?
I love function handles in matlab, I can do this for example: f = @(x,a,b) a*(x.^b); plot(x,f(x,a,b)); This is so use...
거의 9년 전 | 답변 수: 3 | 0
3
답변질문
Multiple conditions for while loop.
while (Ea0 >= 0.01)&&(Ea0 >= 0.01)||(Sr >= 10^-4) This loop keeps on going even though the first part (Ea0 >= 0.01)&&(...
거의 9년 전 | 답변 수: 1 | 1
1
답변질문
How to change the name of the program, and GUI.fig
My friend did the GUI part of this program, I'd appreciate if you told me how to change the name, and a quick overview of it and...
대략 10년 전 | 답변 수: 1 | 0
1
답변질문
Formating and tweaking output
I need to achieve three more things with my program: 1. Make dots appear slowly to correspond to the time it takes for an op...
대략 10년 전 | 답변 수: 0 | 0
0
답변질문
Take input and use it in a function
I''m trying to write a program that can analyze protein relationship. I'm trying to make the user input the accession number of ...
대략 10년 전 | 답변 수: 2 | 0
2
답변질문
Please debug this code for me
I'm trying to make a program based on this tutorial: http://www.mathworks.com/help/bioinfo/examples/using-scoring-matrices-to...
대략 10년 전 | 답변 수: 0 | 0
0
답변질문
Please fix this code
protein1=input('Please input GenPept code of the first protein: ', 's'); protein2=input('Please input GenPept code of the s...
대략 10년 전 | 답변 수: 2 | 0
2
답변질문
Plz explain this code to me!
Hello, I'm trying to understand a program that identifies recognition sites for restriction enzymes of a DNA sequence, and outpu...
대략 10년 전 | 답변 수: 0 | 0
0
답변답변 있음
Why doesn't this matlab code work?!
thank u so much for offering help, i understand what a cell array is now, but i don't understand thsis syntax "y{1}", and sorry ...
Why doesn't this matlab code work?!
thank u so much for offering help, i understand what a cell array is now, but i don't understand thsis syntax "y{1}", and sorry ...
대략 10년 전 | 0
답변 있음
Why doesn't this matlab code work?!
couldn't understand what it says, plus i'm trying to add this line too, can u fix it: cut_position= strfind(s,y) + x -2; i...
Why doesn't this matlab code work?!
couldn't understand what it says, plus i'm trying to add this line too, can u fix it: cut_position= strfind(s,y) + x -2; i...
대략 10년 전 | 0
질문
Why doesn't this matlab code work?!
s={'CCCAGCTCCCGAATTCCCCAGCTA'}; rec={'AG^CT'}; x=strfind(rec,'^'); y=rec; y(x)=[] I get: Error using su...
대략 10년 전 | 답변 수: 4 | 0