통계
All
Feeds
질문
Issue with parfor when using containers.Map
Here is the code of a script that calls a function inside a loop. The function is passed a Map object (created previously). I ...
2년 초과 전 | 답변 수: 0 | 0
0
답변질문
generate all variations on a 20-mer, that are 1 to 4 mismatches away
We consider a kmer. An arbitray k long DNA sequence, consisting of only {A,C,G,T}. For instance, 'ACTGGTCATTTGGGCTGGTA'. Let'...
2년 초과 전 | 답변 수: 1 | 1
1
답변질문
"Warning: udp will be removed in a future release. Use udpport instead."
I do not call udp directly. This warning only appeared after upgrading to Matlab version R2022b from an earlier version. I sus...
거의 3년 전 | 답변 수: 1 | 0
1
답변답변 있음
How to step through vector permutations in a parallel loop, without generating all permutations in advance?
Thanks. That works for me.
How to step through vector permutations in a parallel loop, without generating all permutations in advance?
Thanks. That works for me.
대략 3년 전 | 0
질문
How to step through vector permutations in a parallel loop, without generating all permutations in advance?
I need a paralleised loop to step through all permutations of 1:N Even though for some values of N it is computationally feasib...
대략 3년 전 | 답변 수: 2 | 0
2
답변질문
How to generate M *almost* mutually orthogonal vectors of dimensionality N, where M>>N ?
Generating mutually orthogonal vectors in is easy enough. I am looking for vectors in , where , and the vectors are almost ...
거의 4년 전 | 답변 수: 2 | 0
2
답변질문
How to return a uint64_t from a mex function?
I want to assign to plhs[0] a scalar of type uint64_t. Not sure what function to call. e.g. if I have uint64_t y=123; and I...
대략 4년 전 | 답변 수: 1 | 0
1
답변답변 있음
how to get average of multiple rows and subtract from one group of average to another
Here is a solution to also take care of a number of rows that is not a multiple of your grouping (e.g. 30). I made up a matrix ...
how to get average of multiple rows and subtract from one group of average to another
Here is a solution to also take care of a number of rows that is not a multiple of your grouping (e.g. 30). I made up a matrix ...
거의 5년 전 | 0
답변 있음
how to get average of multiple rows and subtract from one group of average to another
%% load the fille into memory with M = csvread(filename) %% loop around M, 30 rows at a time for i=1:30:si...
how to get average of multiple rows and subtract from one group of average to another
%% load the fille into memory with M = csvread(filename) %% loop around M, 30 rows at a time for i=1:30:si...
거의 5년 전 | 0
질문
Critical code section inside parfor
With C++ one can define critical code section inside a parallel for. Is there a similar construct that can be used with Matla...
거의 5년 전 | 답변 수: 2 | 0
2
답변답변 있음
k distinct combinations of size p without replacement
You can get this as follows: 1. First generate all binary vectors of size 2^N n=dec2bin(0:2^N-1)-'0'; in the examplll...
k distinct combinations of size p without replacement
You can get this as follows: 1. First generate all binary vectors of size 2^N n=dec2bin(0:2^N-1)-'0'; in the examplll...
대략 5년 전 | 0
답변 있음
Find multiple elements in an array.
function out = findMultipleElements(a,b) % Find multiple elements in an array % example: % a = [1 5 2 5 3 5 4 2...
Find multiple elements in an array.
function out = findMultipleElements(a,b) % Find multiple elements in an array % example: % a = [1 5 2 5 3 5 4 2...
대략 5년 전 | 0
질문
Strange "correct" solution to Cody Problem 58. Tic Tac Toe FTW
I see this solution on the Cody solutions list. Solution 1949216 I am puzzled as to how this could possibly be rated as correc...
대략 5년 전 | 답변 수: 1 | 0
1
답변질문
Cody challenge hard coded answers
I have been using something similar to the Cody Challenge problem solving rig for many years (albeit more sophisticated) in teac...
대략 5년 전 | 답변 수: 1 | 0
1
답변답변 있음
MATLAB in research projects
I have used MATLAB since 1992. My first go-to platform. Every time. I am a tragic devotee. As a general computational platform...
MATLAB in research projects
I have used MATLAB since 1992. My first go-to platform. Every time. I am a tragic devotee. As a general computational platform...
대략 6년 전 | 1
질문
PARFOR not using all logical cores
I have seen this quastion asked many times over several years, and I was notable to find a satisfactory answer, let alone a solu...
6년 초과 전 | 답변 수: 1 | 0
1
답변질문
How to generate a set of N mutually orthogonal (N being a power of 2) N-dimensional binary vectors [+1,-1]?
For instance: with N=2 we could have [1 1; 1 -1] with N=4, we could have [1 1 1 1; 1 1 -1 -1; 1 -1 1 -1; 1 -1 -1 1] How to ef...
거의 8년 전 | 답변 수: 3 | 1
3
답변답변 있음
blastformat function
I had the same problem, using Windows. I installed the NCBI blast suite. In the \bin file where it is installed there is a com...
blastformat function
I had the same problem, using Windows. I installed the NCBI blast suite. In the \bin file where it is installed there is a com...
거의 9년 전 | 0









