lilly lord
Content Feed
질문
How to apply DES Sbox 1?
Hi. I want to apply DES Sbox1. S-box1= [ 14 4 13 1 2 15 11 8 3 10 6 12 5 9 0 7 ... 0 15 7 4 14 2 13 1 10 6...
9개월 전 | 답변 수: 1 | 0
1
답변질문
How to replace duplicate elements with the elements of the second array?
Hi , I have two arrays , one with duplicate elements and I want to keep the first occurance of the element and replace other rep...
대략 1년 전 | 답변 수: 2 | 0
2
답변질문
How to keep only a new modification in an array using for loop?
Hello, I have an array named 'a' cocsists of ones and zeros. What I want is If an entry is zero , make it 1 and store the whol...
1년 초과 전 | 답변 수: 1 | 0
1
답변질문
Image hiding inside an image
Hello, I am trying to hide an image inside an image taking one row of the secret image at a time. input = imread('peppers.png'...
1년 초과 전 | 답변 수: 1 | 0
1
답변질문
Error in concatination in binary values
Hi, I am trying to concatinate the two 4-bit binary values to get 8 -bit value and then I have to convert it into decimals. But ...
1년 초과 전 | 답변 수: 2 | 0
2
답변질문
How to write values in a single array
a=[11 23 165 200 213]; a1=de2bi(a,8,'left-msb'); out1=[]; for i=1:length(a) k= mat2cell(a1(i,:),1,[4,4]); k...
1년 초과 전 | 답변 수: 1 | 0
1
답변질문
How to apply S-box on input data?
Hello, I have an S-box and I want to pass few numbers through S-box if x=0,1,2,3,4,5,6,7 then S-box(x)=0,1,3,6,7,4,5,2 A=0:7...
거의 2년 전 | 답변 수: 1 | 0
1
답변질문
How to get all possible permutations in binary format?
Hello, I want to get possible permutation of the vector v which actually contains a boolean values. Suppose the first permutatio...
거의 2년 전 | 답변 수: 1 | 0
1
답변질문
How to run randperm command for 100 times and store these permutations
Hi, I want to run randperm command to generate different permutations and save these permutation . The following code oly shows ...
거의 2년 전 | 답변 수: 1 | 0
1
답변질문
Multiple lines to write using fid open
I have a matrix and some operation is performed on the rows e.g average of each row. I want to store those rows whose average is...
2년 초과 전 | 답변 수: 1 | 0
1
답변질문
Nested for loop for multipication
Hello I am trying to multiply columns of Matrix E with numbers 1 till 5. Columns are taken one by one named as G. When I multipl...
2년 초과 전 | 답변 수: 1 | 0
1
답변질문
How to write disjoint cycles in matlab?
a and b are from S-16 permutation written as disjoint cycle a=(1 3 5 7 9 11) b=(2 4 6 8 10 12 14) . %disjoint cycles a=(1 3 ...
2년 초과 전 | 답변 수: 0 | 0
0
답변질문
How to calculate permutation powers
I have to find higher powers of a permutation. For example if M is a given permutation , then to calculate M^11 M= [ 1 2 ...
2년 초과 전 | 답변 수: 2 | 0
2
답변질문
How to write cyclic permutation as an array in matlab?
I have disjoint permutation cycles such as (1 4 6 2 5 7 8 3)(9 10) means 1 comes under 4th position, 4 will be at 6th position...
2년 초과 전 | 답변 수: 1 | 0
1
답변질문
How to write Multiple data in a single .txt files
Hi I want to write two different outputs in a single .txt file . for example The following code works well . I want to add one...
거의 3년 전 | 답변 수: 0 | 0
0
답변질문
How to map Boolean functions
hi I have elements from 0 to 15 in binary form named as tab1, f is the boolean function s=[0,1,2,3,4,5,6,7,8,9,..15] %% binary ...
거의 3년 전 | 답변 수: 1 | 0
1
답변질문
Error in Chaotic attracter
Hi I am trying to plot the following equations t_n = c - 6/(1+x_n ^2 + y_n^2); w_n+1 =1+u*(w_n*cos(t_n)-s_n*sin(t_n)); s_n+...
대략 3년 전 | 답변 수: 0 | 0
0
답변질문
Error in fprint command
Hi. here is part of my code. i am getting error in f print command. The code and error message is also attached. If any one can ...
대략 3년 전 | 답변 수: 1 | 0
1
답변질문
Matlab Function returns values
Hi. I have written a function which should return two sequences but it returns only single sequence. I have attached the code be...
대략 3년 전 | 답변 수: 1 | 0
1
답변질문
Permutation based on array indices
Hi. I want to permute elemnts of a row matrix w.rt to anothe matrix of the same dimension. Below is the part of the code but it ...
대략 3년 전 | 답변 수: 1 | 0
1
답변질문
Array element containing infinity
Hi. I have a problem in array indexing containing infinity. I have to compute the function f(a)=1-1/a mod 13 . It takes values ...
3년 초과 전 | 답변 수: 0 | 0
0
답변질문
How to permute binary numbers to a specific permutation
Hi I have numbers in binary form. I want to permute to 1 digit to right so that a new binary value is created. 0 F=[0 6 2 5 4...
3년 초과 전 | 답변 수: 1 | 0
1
답변질문
Row and Column permutation of a matrix
Hi I want to permute each row and column of the matrix using specified permutation e.g %%%%%Permute each row by a certain perm...
3년 초과 전 | 답변 수: 1 | 0
1
답변질문
Error in If else statement
Hi I am getting error in if else statement but dont know where is the mistake. Points=[]; for i=1:257 if i == 16 & i =...
3년 초과 전 | 답변 수: 1 | 0
1
답변질문
Generating matrix from another array
I am tring to generate a matrix S1,S2,S3 from an array E3 . All three matrices should contain numbers from 0 to 25 but in the ...
3년 초과 전 | 답변 수: 1 | 0
1
답변질문
How to multiply one elements with rest of the elements in Galois field
Hi, I am working in Galois field, The generated field is GF( 2^4) p=2; n=4; poly=[1 1 0 0 1]; field1=gftuple([-1:p^n-2]',pol...
3년 초과 전 | 답변 수: 0 | 0
0
답변질문
Bit xor of row with the next row and the output is again xored with the next row
Hi, I have a image and I want to xor first row with single number then Xor 2nd row with first, the output is xored aith the next...
3년 초과 전 | 답변 수: 1 | 0
1
답변질문
Bit xor of two binary strings and conversion into decimal
Hi, I have two large binary strings (e.g 256 bits each), then how to perform bit Xor operation and then convert the answer into...
거의 4년 전 | 답변 수: 2 | 0
2
답변질문
Dna encoding rule1
Hi I have an issue storing the DNA sequenc using for loop. If some one can help me. x=[2 34 50 21]; [m n]=size(x); mn=m*n; P...
거의 4년 전 | 답변 수: 0 | 0
0
답변질문
Addition of two DNA sequenc
Hi, I have a problem in DNA addition %%%%%%DNA addition P_ DNA1='ACAAGGGTTTAAACCCTTAC'; P_DNA2='TTTTGGGAAATGTGACAT...
거의 4년 전 | 답변 수: 1 | 0