Feeds
질문
How to output the longest character string from two specified characters using nested for loop?
% ptn is the string we are working with to find M and * ptn = 'TFASDTTVFTSNLKQTPWCI*LLRRSLPLLPCGAR*TWMKLVVRPWAGWYQGYKTGLRRPIETG...
거의 3년 전 | 답변 수: 1 | 0
1
답변질문
How do I take my generated string outputs from for loop and return a list?
seq = 'ACAUUUGCUUCUGACACAACUGUGUUCACUAGCAACCUCAAACAGACA' for i=1:3:numel(seq)-2 a = (seq(i:i+2)) end a = 'ACA' a = 'UU...
거의 3년 전 | 답변 수: 2 | 0
2
답변질문
How do I prevent duplicate indexes in an array from subtracting to each other when it satisfies the condition the 1st time?
matA = [21 36 172 246 259 274 303 311 316 322 340 375 377 378 382 396 483 508] matB = [39 116 198 203 309 314 364 421] A = 1:1...
거의 3년 전 | 답변 수: 1 | 0
1
답변질문
Having vector sorted by using While Loops + Diff()
Hi. My function has to sort a numerical vector by using only while loops, diff(),any(), or all() Must Use a While Loop No Fo...
5년 초과 전 | 답변 수: 1 | 0
1
답변질문
Finding Largest Factor Using While Loop
Objective: Find largest factor of any input For example: >> out = largestfactor(15) out = 5 I am using a while loop and if...
5년 초과 전 | 답변 수: 1 | 0
