How do I generate a random dna sequence without specific codons?

Hi all,
I am trying to figure out how to use randseq to generate a random dna sequence that excludes stop codons TAG, TAA, and TGA. I think it has to do with 'Case', but I am having difficulty finding information elsewhere.
Thank you!

답변 (1개)

Akira Agata
Akira Agata 2018년 3월 7일
randseq function does not have the option to exclude stop codons. The following is one possible solution to generate random sequence without stop codons.
% List of all possible combination
C = {'A','T','G','C'};
[x,y,z] = meshgrid(C,C,C);
list = strcat(x(:), y(:), z(:));
% Delete stop codons from the list
idx = ismember(list,{'TAG','TAA','TGA'});
list(idx) = [];
% Generate random sequence with N codons
N = 10;
idx = randi([1 numel(list)],1,N);
randSeq = [list{idx}];
The result is:
>> randSeq
randSeq =
'TGCATTTACAATGCCTCTCTAATTGAGCGT'

댓글 수: 1

More simple solution is to use randseq function and erase stop codons, like the following. But please note that this solution can not guarantee the output sequence length.
% Generate random sequence
randSeq = randseq(60);
% Erase stop codons
randSeq = erase(randSeq,{'TAG','TAA','TGA'});

댓글을 달려면 로그인하십시오.

카테고리

도움말 센터File Exchange에서 Genomics and Next Generation Sequencing에 대해 자세히 알아보기

질문:

2018년 3월 6일

댓글:

2018년 3월 7일

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Translated by