how to split dna sequence into three letters each

조회 수: 15 (최근 30일)
Aarsha mv
Aarsha mv 2017년 5월 12일
답변: Luuk van Oosten 2017년 5월 12일
how to split a dna sequence into three letters each
  댓글 수: 3
Stephen23
Stephen23 2017년 5월 12일
편집: Stephen23 2017년 5월 12일
Pick from:
reshape
reshape and num2cell
mat2cell
regexp
...
John D'Errico
John D'Errico 2017년 5월 12일
Get used to working in MATLAB where you think about variables in terms of their shape, their size, as complete arrays. Think of things in terms of how you can transform those arrays into what will be useful to you. Then do some quick reading in the help of the tools in matfun.
help elmat
There are many useful tools in elmat. Some of them, like reshape, might be useful to you.

댓글을 달려면 로그인하십시오.

답변 (1개)

Luuk van Oosten
Luuk van Oosten 2017년 5월 12일
Dear Aarsha mv,
I assume you want to get the codons from your piece of DNA, but correct me if I am wrong.
Let us take the example of a piece of DNA coding for the protein insulin (I took a part of this piece of DNA).
Define a string of nucleotides as being your DNA sequence:
your_DNA = 'CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTG';
To get the codons you can use 'reshape', as was suggested by Stephen Cobeldick and John D'Errico.
Use reshape as follows:
codons = reshape(your_DNA(:),3,length(your_DNA)/3)'
In a 'real life' scenario you would probably need a workaround if length(your_DNA) is not a number that can be divided by 3.
Besides having a look at the tips that Cobeldick and d'Errico already gave you, I suggest you have a look at the Nucleotide Sequence Analysis overview page. There might be some functions that will aid you in your DNA analysis.

카테고리

Help CenterFile Exchange에서 Genomics and Next Generation Sequencing에 대해 자세히 알아보기

태그

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Translated by