Binary to DNA sequence encoding - matlab
조회 수: 11 (최근 30일)
이전 댓글 표시
I am implementing DNA encryption algorithm.
For that, I have a vector containing binary values such as:
01100011 01110010 01111001 01110000 01110100 01101111.
Now, these values should be mapped to DNA sequence. How do I do that in MATLAB?
댓글 수: 2
Star Strider
2015년 9월 20일
DNA has four bases (two complementary sets, A-T and C-G) and you have a binary sequence ...
채택된 답변
Image Analyst
2015년 9월 20일
Perhaps this:
% Assign sample data.
binaryArray = [0,1,1,0,0,0,1,1, 0,1,1,1,0,0,1,0, 0,1,1,1,1,0,0,1, 0,1,1,1,0,0,0,0, 0,1,1,1,0,1,0,0, 0,1,1,0,1,1,1,1];
% Define base letters to choose from.
bases = 'ATGC';
for k = 1 : 2 : length(binaryArray)
% Convert these two digits into a number 1 - 4.
index = 2 * binaryArray(k) + binaryArray(k+1) + 1;
% Use that index to assign a letter to our result.
result((k+1)/2) = bases(index);
end
% Display in command window:
result
It shows:
result =
TGACTCAGTCGTTCAATCTATGCC
댓글 수: 12
Image Analyst
2021년 2월 5일
Shiva, I'm not sure who you're asking, but personally I don't have any to give you.
추가 답변 (0개)
참고 항목
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!