photo

Hyeokjin Jho


Last seen: 6일 전 |  2018년부터 활동

Followers: 0   Following: 0

통계학

All
  • Thankful Level 2
  • Revival Level 2
  • Knowledgeable Level 2
  • Introduction to MATLAB Master
  • Commenter
  • 3 Month Streak
  • Personal Best Downloads Level 1
  • First Submission
  • First Answer
  • Thankful Level 1
  • Solver

배지 보기

Feeds

보기 기준

답변 있음
Is there any way to set function (or method) output as comma separated list?
I found a workaround by using properties with custom get method. classdef myObject properties myProp end ...

2년 초과 전 | 0

답변 있음
MATLAB shows wrong RSA fingerprint in source control
https://kr.mathworks.com/matlabcentral/answers/494543-why-do-i-receive-an-auth-fail-error-when-interacting-with-a-git-remote-ove...

거의 3년 전 | 0

답변 있음
Workaround for linking separate axes without breaking the first link?
Use linkprop ax(1) = subplot(2,2,1); ax(2) = subplot(2,2,2); ax(3) = subplot(2,2,3); l1 = linkprop(ax([1,2]),'ylim'); l2 ...

대략 3년 전 | 0

| 수락됨

답변 있음
Pairwise comparision matrix considering a permutation
A=[2 3; 4 7; 5 4; 2 1]; len = size(A,1); idx(:,1) = repelem(1:len,len); idx(:,2) = repmat(1:len,...

대략 3년 전 | 0

| 수락됨

답변 있음
How does clearing nested function workspace works?
While I study Javascript, I learned this behaviour is called closure "A closure is a function having access to the parent scope...

3년 초과 전 | 0

질문


How to change terminal PFI of DAQ channel?
I am using NI 6052E. I have to count input pulse using counter ctr0. The input signal is physically connected to PFI0. However,...

3년 초과 전 | 답변 수: 0 | 0

0

답변

답변 있음
How to pass a struct as name-value-pairs to a function?
try namedargs2cell

3년 초과 전 | 3

답변 있음
How do I add error bars to the data points of a fitted surface?
Try surferror : https://www.mathworks.com/matlabcentral/fileexchange/73699-surferror

3년 초과 전 | 0

질문


How does clearing nested function workspace works?
I found that this code works : function main message = 'hello world!'; figure; uicontrol('style','pushbutton',.....

대략 4년 전 | 답변 수: 2 | 0

2

답변

답변 있음
Index in position 2 exceeds array bounds
Since n = 4, for(j=1:1:n-1) will make j from 1 to 3. However pos is 4x2 matrix. When j is 3, pos(1,j) refers outside of the mat...

4년 초과 전 | 0

답변 있음
What do the pixelIdxlist mean?
Let's say your image input for bwconncomp is BW. i.e. CC = bwconncomp(BW); Then CC.pixelIdxList{i} is linear indices of i-th i...

4년 초과 전 | 0

답변 있음
Visualization of data in 3 dimention.
F=5:1:50; % total 46 value w=2*pi*F; S=0:1:100;%total 101 value [wM,SM]=meshgrid(w,S); P = SM./wM; surf(w,S,P) You can c...

4년 초과 전 | 1

| 수락됨

답변 있음
comparing pixels in 3x3 block
Assuming your matrix is A % collect green pixels query_right = A(2:end-1,3:end); query_left = A(2:end-1,1:end-2); query_dow...

4년 초과 전 | 1

| 수락됨

답변 있음
How do I add error bars in the Z-axis to a surface plot?
https://kr.mathworks.com/matlabcentral/fileexchange/73699-surferror try this

4년 초과 전 | 1

질문


Collapsing preallocated memory of sparse matrix
I used sparse matrix for some calculation, and I roughly know how many nnz will be stored. So I preallocated a slightly larger m...

5년 초과 전 | 답변 수: 1 | 1

1

답변

질문


Is there any way to set function (or method) output as comma separated list?
If we have an array of struct, like this: s(1).a = 1; s(2).a = 2; s(3).a = 3; and then if we get the field of this...

5년 초과 전 | 답변 수: 2 | 0

2

답변

답변 있음
Matrix Manipulation of a specific column
Assuming |Data| is the matrix that containing your data, threshold = 10; for i = size(Data,2) pickedColumn = ...

거의 6년 전 | 0

질문


How to get all possible rearrange permutations of array with repeated elements?
I have some DNA sequences to rearrange 'ACTCACATCTGGTTCCTCTA' and I need all possible permutations of this (4 'A', 7 'T'...

거의 6년 전 | 답변 수: 1 | 0

1

답변