how to convert a long list into an array with semicolongs

I'm pretty new to MatLab but while this seems very simple I can't find an answer

I am downloading amino acid or nucelotide sequences from the NIH data base, and these appear like

CGTGAATACAAAAATATGCCAGCTTGCTAATATAATAACGATGTTTTCAAATCCATTAAGTTAACAACAA

that go on for hundreds or thousands of letters

I'm using each letter to trigger a different event, in this case play a different sound

to do so I need each letter separated by a semicolon, which I believe makes it a separate row in an array

is there an instruction that will take a string of letters as above and insert a semicolon between the letters?

thanks very much, Dave

Answer 1

[Simon]

Hi!

What exactly do you need? Do you have a loop for playing sounds according to the letters?

for n = 1:length(str)
  switch (str(n))
    case 'C'
      % play a C
    case 'G'
      % play a G
    case 'T'
      % play a T
    case 'A'
      % play a A
  end
end

Answer 2

[David]

Simon, thanks very much for your help

so, first I tried this

for n = 1:length(ORFMAPT)

switch (ORFMAPT(n))
  case 'C'
    sound(C)
  case 'G'
    sound(G)
  case 'T'
    sound(T)
  case 'A'
    sound(A)
end
end

where ORFMAPT is a long list of nucleotides 'atcgcgtat...' and the sounds are ones I entered and named C,G,T,A= if I just write sound(A) and return I get the sound, but if I use the above, nothing plays. If you have any advice, very appreciated.

Essentially if something like this works the original question is moot, as I won't need to place each amino acid or nucleotide in an array

thanks again, Dave

[Simon]

Hi!

Is your string composed of upper or lower case letters? Try using the "upper" function in

switch upper(ORFMAPT(n))