How to get all possible rearrange permutations of array with repeated elements?
조회 수: 5 (최근 30일)
이전 댓글 표시
I have some DNA sequences to rearrange
'ACTCACATCTGGTTCCTCTA'
and I need all possible permutations of this (4 'A', 7 'T', 7 'C', 2 'G'). For example,
'AAAATTTTTTTCCCCCCCGG',
'AAATATTTTTTCCCCCCCGG',
'AATAATTTTTTCCCCCCCGG',
...
I used
unique(perms('ACTCACATCTGGTTCCTCTA'),'rows');
It works for smaller array. But for this array, it results error because perms with 20 elements takes up too much memory ( numel is 20! = 2.43e+18).
Actual numbers of permutation would be 20!/4!/7!/7!/2! = 2.00e+09. It's a lot, but still it fits on my memory.
So is there any better way?
댓글 수: 0
채택된 답변
추가 답변 (0개)
참고 항목
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!