How to get all possible rearrange permutations of array with repeated elements?

I have some DNA sequences to rearrange

 'ACTCACATCTGGTTCCTCTA'

and I need all possible permutations of this (4 'A', 7 'T', 7 'C', 2 'G'). For example,

 'AAAATTTTTTTCCCCCCCGG',
 'AAATATTTTTTCCCCCCCGG',
 'AATAATTTTTTCCCCCCCGG',
...

I used

unique(perms('ACTCACATCTGGTTCCTCTA'),'rows');

It works for smaller array. But for this array, it results error because perms with 20 elements takes up too much memory ( numel is 20! = 2.43e+18).

Actual numbers of permutation would be 20!/4!/7!/7!/2! = 2.00e+09. It's a lot, but still it fits on my memory.

So is there any better way?

Answer 1

[KSSV]

Try this from file exchange:

https://in.mathworks.com/matlabcentral/fileexchange/26397-vchooseko