How to get all possible rearrange permutations of array with repeated elements?

조회 수: 5 (최근 30일)
I have some DNA sequences to rearrange
'ACTCACATCTGGTTCCTCTA'
and I need all possible permutations of this (4 'A', 7 'T', 7 'C', 2 'G'). For example,
'AAAATTTTTTTCCCCCCCGG',
'AAATATTTTTTCCCCCCCGG',
'AATAATTTTTTCCCCCCCGG',
...
I used
unique(perms('ACTCACATCTGGTTCCTCTA'),'rows');
It works for smaller array. But for this array, it results error because perms with 20 elements takes up too much memory ( numel is 20! = 2.43e+18).
Actual numbers of permutation would be 20!/4!/7!/7!/2! = 2.00e+09. It's a lot, but still it fits on my memory.
So is there any better way?

채택된 답변

KSSV
KSSV 2018년 9월 17일

추가 답변 (0개)

카테고리

Help CenterFile Exchange에서 Elementary Math에 대해 자세히 알아보기

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Translated by