Main Content

이 번역 페이지는 최신 내용을 담고 있지 않습니다. 최신 내용을 영문으로 보려면 여기를 클릭하십시오.

string형 배열과 문자형 배열 내에 포함된 텍스트

MATLAB®에서 텍스트를 표현하는 방법에는 두 가지가 있습니다. R2016b부터는 텍스트를 string형 배열로 저장할 수 있습니다. MATLAB의 모든 버전에서는 텍스트를 문자형 배열로 저장할 수 있습니다. 일반적으로 문자형 배열은 텍스트 조각을 문자형 벡터로 저장할 때 사용할 수 있습니다. MATLAB에서는 큰따옴표로 string형을 표시하고 작은따옴표로 문자형 벡터를 표시합니다.

string형 배열로 텍스트 표시하기

string 데이터형을 사용하여 1×n 크기의 문자 시퀀스를 string형으로 저장할 수 있습니다. R2017a부터는 string형을 생성할 때 텍스트를 큰따옴표로 묶으십시오.

str = "Hello, world"
str = 
"Hello, world"

텍스트 "Hello, world"는 12자이지만 str 자체는 1×1 string형 또는 string형 스칼라입니다. string형 스칼라를 사용하여 파일 이름, 플롯 레이블 또는 텍스트로 된 기타 정보를 지정할 수 있습니다.

문자열에 포함된 문자 수를 구하려면 strlength 함수를 사용하십시오.

n = strlength(str)
n = 12

텍스트에 큰따옴표가 포함되어 있는 경우에는 정의할 때 두 개의 큰따옴표를 사용하십시오.

str = "They said, ""Welcome!"" and waved."
str = 
"They said, "Welcome!" and waved."

문자열 끝에 텍스트를 추가하려면 플러스 연산자 +를 사용하십시오. 변수는 string형으로 변환할 수 있는 경우 plus에 의해 변환되어 추가됩니다.

fahrenheit = 71;
celsius = (fahrenheit-32)/1.8;
tempText = "temperature is " + celsius + "C"
tempText = 
"temperature is 21.6667C"

R2019a부터는 append 함수를 사용하여 텍스트를 결합할 수도 있습니다.

tempText2 = append("Today's ",tempText)
tempText2 = 
"Today's temperature is 21.6667C"

string 함수는 숫자형 값, datetime형 값, duration형 값 및 categorical형 값 같은 여러 다른 유형의 입력값을 변환할 수 있습니다. 예를 들어, pi의 출력값을 string형으로 변환해 보겠습니다.

ps = string(pi)
ps = 
"3.1416"

string형 배열에 여러 텍스트 조각을 저장할 수 있습니다. 배열의 각 요소는 공백으로 채우지 않고도 문자 개수가 서로 다른 문자열을 포함할 수 있습니다.

str = ["Mercury","Gemini","Apollo";...
       "Skylab","Skylab B","ISS"]
str = 2x3 string
    "Mercury"    "Gemini"      "Apollo"
    "Skylab"     "Skylab B"    "ISS"   

str은 2×3 string형 배열입니다. strlength 함수로 문자열의 길이를 구할 수 있습니다.

N = strlength(str)
N = 2×3

     7     6     6
     6     8     3

R2018b부터 string형 배열이 MATLAB 및 MathWorks® 제품에서 지원됩니다. 문자형 배열(또는 문자형 벡터로 구성된 셀형 배열)을 입력값으로 받는 함수는 string형 배열도 받습니다.

문자형 벡터로 텍스트 표시하기

n 크기의 문자 시퀀스를 문자형 벡터로 저장하려면 char 데이터형을 사용하여 문자 시퀀스를 작은따옴표로 묶으십시오.

chr = 'Hello, world'
chr = 
'Hello, world'

텍스트 'Hello, world'는 12자이며 chr은 이 텍스트를 1×12 문자형 벡터로 저장합니다.

whos chr
  Name      Size            Bytes  Class    Attributes

  chr       1x12               24  char               

텍스트에 작은따옴표가 포함되어 있는 경우에는 정의할 때 두 개의 작은따옴표를 사용하십시오.

chr = 'They said, ''Welcome!'' and waved.'
chr = 
'They said, 'Welcome!' and waved.'

문자형 벡터는 주로 두 가지 경우에 사용됩니다.

  • 파일 이름과 플롯 레이블 같은 하나의 텍스트 조각을 지정하려는 경우.

  • 문자를 사용하여 인코딩된 데이터를 표시하려는 경우. 이 경우, 개별 문자에 손쉽게 액세스해야 할 수 있습니다.

예를 들어, DNA 염기 서열을 문자형 벡터로 저장할 수 있습니다.

seq = 'GCTAGAATCC';

숫자형 배열의 요소를 참조하는 것처럼 인덱싱을 통해 개별 문자 또는 문자 중 일부에 액세스할 수 있습니다.

seq(4:6)
ans = 
'AGA'

다른 배열 유형을 결합할 때와 마찬가지로 대괄호를 사용하여 문자형 벡터를 결합합니다.

seq2 = [seq 'ATTAGAAACC']
seq2 = 
'GCTAGAATCCATTAGAAACC'

R2019a부터는 append를 사용하여 텍스트를 결합할 수도 있습니다. append 함수는 string형 배열, 문자형 벡터, 문자형 벡터로 구성된 셀형 배열을 일관되게 처리하기 때문에 이 함수를 사용하는 것이 권장됩니다.

seq2 = append(seq,'ATTAGAAACC')
seq2 = 
'GCTAGAATCCATTAGAAACC'

string형 배열을 입력값으로 받는 MATLAB 함수는 문자형 벡터와 문자형 벡터로 구성된 셀형 배열도 받습니다.

참고 항목

| | | | | |

관련 항목