Main Content

이 페이지의 최신 내용은 아직 번역되지 않았습니다. 최신 내용은 영문으로 볼 수 있습니다.

string형 배열과 문자형 배열 내에 포함된 텍스트

MATLAB®에서 텍스트를 표현하는 방법에는 두 가지가 있습니다. R2016b부터는 텍스트를 string형 배열로 저장할 수 있습니다. MATLAB의 모든 버전에서는 텍스트를 문자형 배열로 저장할 수 있습니다. 일반적으로 문자형 배열은 텍스트 조각을 문자형 벡터로 저장할 때 사용할 수 있습니다. MATLAB에서는 큰따옴표로 string형을 표시하고 작은따옴표로 문자형 벡터를 표시합니다.

string형 배열로 텍스트 표시하기

string 데이터형을 사용하여 1xn 크기의 문자 시퀀스를 string형으로 저장할 수 있습니다. R2017a부터는 string형을 생성할 때 텍스트를 큰따옴표로 묶으십시오.

str = "Hello, world"
str = 
"Hello, world"

텍스트 "Hello, world"는 12자이지만 str 자체는 1x1 string형 또는 string형 스칼라입니다. string형 스칼라를 사용하여 파일 이름, 플롯 레이블 또는 텍스트로 된 기타 정보를 지정할 수 있습니다.

문자열에 포함된 문자 수를 구하려면 strlength 함수를 사용하십시오.

n = strlength(str)
n = 12

텍스트에 큰따옴표가 포함되어 있는 경우에는 정의할 때 두 개의 큰따옴표를 사용하십시오.

str = "They said, ""Welcome!"" and waved."
str = 
"They said, "Welcome!" and waved."

문자열 끝에 텍스트를 추가하려면 플러스 연산자 +를 사용하십시오. 변수는 string형으로 변환할 수 있는 경우 plus에 의해 변환되어 추가됩니다.

fahrenheit = 71;
celsius = (fahrenheit-32)/1.8;
tempText = "temperature is " + celsius + "C"
tempText = 
"temperature is 21.6667C"

R2019a부터는 append 함수를 사용하여 텍스트를 결합할 수도 있습니다.

tempText2 = append("Today's ",tempText)
tempText2 = 
"Today's temperature is 21.6667C"

string 함수는 숫자형 값, datetime형 값, duration형 값 및 categorical형 값 같은 여러 다른 유형의 입력값을 변환할 수 있습니다. 예를 들어, pi의 출력값을 string형으로 변환해 보겠습니다.

ps = string(pi)
ps = 
"3.1416"

string형 배열에 여러 텍스트 조각을 저장할 수 있습니다. 배열의 각 요소는 공백으로 채우지 않고도 문자 개수가 서로 다른 문자열을 포함할 수 있습니다.

str = ["Mercury","Gemini","Apollo";...
       "Skylab","Skylab B","ISS"]
str = 2x3 string
    "Mercury"    "Gemini"      "Apollo"
    "Skylab"     "Skylab B"    "ISS"   

str은 2x3 string형 배열입니다. strlength 함수로 문자열의 길이를 구할 수 있습니다.

N = strlength(str)
N = 2×3

     7     6     6
     6     8     3

R2018b부터 string형 배열이 MATLAB 및 MathWorks® 제품에서 지원됩니다. 문자형 배열(또는 문자형 벡터로 구성된 셀형 배열)을 입력값으로 받는 함수는 string형 배열도 받습니다.

문자형 벡터로 텍스트 표시하기

1xn 크기의 문자 시퀀스를 문자형 벡터로 저장하려면 char 데이터형을 사용하여 문자 시퀀스를 작은따옴표로 묶으십시오.

chr = 'Hello, world'
chr = 
'Hello, world'

텍스트 'Hello, world'는 12자이며 chr은 이 텍스트를 1x12 문자형 벡터로 저장합니다.

whos chr
  Name      Size            Bytes  Class    Attributes

  chr       1x12               24  char               

텍스트에 작은따옴표가 포함되어 있는 경우에는 정의할 때 두 개의 작은따옴표를 사용하십시오.

chr = 'They said, ''Welcome!'' and waved.'
chr = 
'They said, 'Welcome!' and waved.'

문자형 벡터는 주로 두 가지 경우에 사용됩니다.

  • 파일 이름과 플롯 레이블 같은 하나의 텍스트 조각을 지정하려는 경우.

  • 문자를 사용하여 인코딩된 데이터를 표시하려는 경우. 이 경우, 개별 문자에 손쉽게 액세스해야 할 수 있습니다.

예를 들어, DNA 염기 서열을 문자형 벡터로 저장할 수 있습니다.

seq = 'GCTAGAATCC';

숫자형 배열의 요소를 참조하는 것처럼 인덱싱을 통해 개별 문자 또는 문자 중 일부에 액세스할 수 있습니다.

seq(4:6)
ans = 
'AGA'

다른 배열 유형을 결합할 때와 마찬가지로 대괄호를 사용하여 문자형 벡터를 결합합니다.

seq2 = [seq 'ATTAGAAACC']
seq2 = 
'GCTAGAATCCATTAGAAACC'

R2019a부터는 append를 사용하여 텍스트를 결합할 수도 있습니다. append 함수는 string형 배열, 문자형 벡터, 문자형 벡터로 구성된 셀형 배열을 일관되게 처리하기 때문에 이 함수를 사용하는 것이 권장됩니다.

seq2 = append(seq,'ATTAGAAACC')
seq2 = 
'GCTAGAATCCATTAGAAACC'

string형 배열을 입력값으로 받는 MATLAB 함수는 문자형 벡터와 문자형 벡터로 구성된 셀형 배열도 받습니다.

참고 항목

| | | | | |

관련 항목