getgenbank
Retrieve sequence information from GenBank database
Syntax
Description
getgenbank( displays
information in the MATLAB® Command Window without returning data to a variable. The displayed information
is only hyperlinks to the URLs used to search for and retrieve the data. The
AccessionNumber)getgenbank function retrieves nucleotide information from the
GenBank® database. This database is maintained by the National Center for Biotechnology
Information (NCBI). For more details about the GenBank database, see https://www.ncbi.nlm.nih.gov/Genbank/.
searches for the accession number in the GenBank database and returns Data = getgenbank(AccessionNumber)Data, a MATLAB structure containing information for the sequence.
Tip
If an error occurs while retrieving the GenBank-formatted information, try rerunning the query. Errors can occur due to Internet connectivity issues that are unrelated to the GenBank record.
getgenbank(___,
specifies options using one or more name-value arguments in addition to the input arguments
in previous syntaxes. Each name-value argument is case insensitive.Name=Value)
calls
Data = getgenbank(___)getgenbank returns Data, a MATLAB structure containing information for the sequence.
Examples
This example shows how to retrieve the sequence from chromosome 19, M10051, that codes for the human insulin receptor and store it in a structure, S.
S = getgenbank('M10051')S = struct with fields:
LocusName: 'HUMINSR'
LocusSequenceLength: '4723'
LocusNumberofStrands: ''
LocusTopology: 'linear'
LocusMoleculeType: 'mRNA'
LocusGenBankDivision: 'PRI'
LocusModificationDate: '06-JAN-1995'
Definition: 'Human insulin receptor mRNA, complete cds.'
Accession: 'M10051'
Version: 'M10051.1'
GI: ''
Project: []
DBLink: []
Keywords: 'insulin receptor; tyrosine kinase.'
Segment: []
Source: 'Homo sapiens (human)'
SourceOrganism: [4×65 char]
Reference: {[1×1 struct]}
Comment: [14×67 char]
Features: [50×74 char]
CDS: [1×1 struct]
Sequence: 'ggggggctgcgcggccgggtcggtgcgcacacgagaaggacgcgcggcccccagcgctcttgggggccgcctcggagcatgacccccgcgggccagcgccgcgcgcctgatccgaggagaccccgcgctcccgcagccatgggcaccgggggccggcggggggcggcggccgcgccgctgctggtggcggtggccgcgctgctactgggcgccgcgggccacctgtaccccggagaggtgtgtcccggcatggatatccggaacaacctcactaggttgcatgagctggagaattgctctgtcatcgaaggacacttgcagatactcttgatgttcaaaacgaggcccgaagatttccgagacctcagtttccccaaactcatcatgatcactgattacttgctgctcttccgggtctatgggctcgagagcctgaaggacctgttccccaacctcacggtcatccggggatcacgactgttctttaactacgcgctggtcatcttcgagatggttcacctcaaggaactcggcctctacaacctgatgaacatcacccggggttctgtccgcatcgagaagaacaatgagctctgttacttggccactatcgactggtcccgtatcctggattccgtggaggataatcacatcgtgttgaacaaagatgacaacgaggagtgtggagacatctgtccgggtaccgcgaagggcaagaccaactgccccgccaccgtcatcaacgggcagtttgtcgaacgatgttggactcatagtcactgccagaaagtttgcccgaccatctgtaagtcacacggctgcaccgccgaaggcctctgttgccacagcgagtgcctgggcaactgttctcagcccgacgaccccaccaagtgcgtggcctgccgcaacttctacctggacggcaggtgtgtggagacctgcccgcccccgtactaccacttccaggactggcgctgtgtgaacttcagcttctgccaggacctgcaccacaaatgcaagaactcgcggaggcagggctgccaccaatacgtcattcacaacaacaagtgcatccctgagtgtccctccgggtacacgatgaattccagcaacttgctgtgcaccccatgcctgggtccctgtcccaaggtgtgccacctcctagaaggcgagaagaccatcgactcggtgacgtctgcccaggagctccgaggatgcaccgtcatcaacgggagtctgatcatcaacattcgaggaggcaacaatctggcagctgagctagaagccaacctcggcctcattgaagaaatttcagggtatctaaaaatccgccgatcctacgctctggtgtcactttccttcttccggaagttacgtctgattcgaggagagaccttggaaattgggaactactccttctatgccttggacaaccagaacctaaggcagctctgggactggagcaaacacaacctcaccaccactcaggggaaactcttcttccactataaccccaaactctgcttgtcagaaatccacaagatggaagaagtttcaggaaccaaggggcgccaggagagaaacgacattgccctgaagaccaatggggacaaggcatcctgtgaaaatgagttacttaaattttcttacattcggacatcttttgacaagatcttgctgagatgggagccgtactggccccccgacttccgagacctcttggggttcatgctgttctacaaagaggccccttatcagaatgtgacggagttcgatgggcaggatgcgtgtggttccaacagttggacggtggtagacattgacccacccctgaggtccaacgaccccaaatcacagaaccacccagggtggctgatgcggggtctcaagccctggacccagtatgccatctttgtgaagaccctggtcaccttttcggatgaacgccggacctatggggccaagagtgacatcatttatgtccagacagatgccaccaacccctctgtgcccctggatccaatctcagtgtctaactcatcatcccagattattctgaagtggaaaccaccctccgaccccaatggcaacatcacccactacctggttttctgggagaggcaggcggaagacagtgagctgttcgagctggattattgcctcaaagggctgaagctgccctcgaggacctggtctccaccattcgagtctgaagattctcagaagcacaaccagagtgagtatgaggattcggccggcgaatgctgctcctgtccaaagacagactctcagatcctgaaggagctggaggagtcctcgtttaggaagacgtttgaggattacctgcacaacgtggttttcgtccccagaaaaacctcttcaggcactggtgccgaggaccctaggccatctcggaaacgcaggtcccttggcgatgttgggaatgtgacggtggccgtgcccacggtggcagctttccccaacacttcctcgaccagcgtgcccacgagtccggaggagcacaggccttttgagaaggtggtgaacaaggagtcgctggtcatctccggcttgcgacacttcacgggctatcgcatcgagctgcaggcttgcaaccaggacacccctgaggaacggtgcagtgtggcagcctacgtcagtgcgaggaccatgcctgaagccaaggctgatgacattgttggccctgtgacgcatgaaatctttgagaacaacgtcgtccacttgatgtggcaggagccgaaggagcccaatggtctgatcgtgctgtatgaagtgagttatcggcgatatggtgatgaggagctgcatctctgcgtctcccgcaagcacttcgctctggaacggggctgcaggctgcgtgggctgtcaccggggaactacagcgtgcgaatccgggccacctcccttgcgggcaacggctcttggacggaacccacctatttctacgtgacagactatttagacgtcccgtcaaatattgcaaaaattatcatcggccccctcatctttgtctttctcttcagtgttgtgattggaagtatttatctattcctgagaaagaggcagccagatgggccgctgggaccgctttacgcttcttcaaaccctgagtatctcagtgccagtgatgtgtttccatgctctgtgtacgtgccggacgagtgggaggtgtctcgagagaagatcaccctccttcgagagctggggcagggctccttcggcatggtgtatgagggcaatgccagggacatcatcaagggtgaggcagagacccgcgtggcggtgaagacggtcaacgagtcagccagtctccgagagcggattgagttcctcaatgaggcctcggtcatgaagggcttcacctgccatcacgtggtgcgcctcctgggagtggtgtccaagggccagcccacgctggtggtgatggagctgatggctcacggagacctgaagagctacctccgttctctgcggccagaggctgagaataatcctggccgccctccccctacccttcaagagatgattcagatggcggcagagattgctgacgggatggcctacctgaacgccaagaagtttgtgcatcgggacctggcagcgagaaactgcatggtcgcccatgattttactgtcaaaattggagactttggaatgaccagagacatctatgaaacggattactaccggaaagggggcaagggtctgctccctgtacggtggatggcaccggagtccctgaaggatggggtcttcaccacttcttctgacatgtggtcctttggcgtggtcctttgggaaatcaccagcttggcagaacagccttaccaaggcctgtctaatgaacaggtgttgaaatttgtcatggatggagggtatctggatcaacccgacaactgtccagagagagtcactgacctcatgcgcatgtgctggcaattcaaccccaagatgaggccaaccttcctggagattgtcaacctgctcaaggacgacctgcaccccagctttccagaggtgtcgttcttccacagcgaggagaacaaggctcccgagagtgaggagctggagatggagtttgaggacatggagaatgtgcccctggaccgttcctcgcactgtcagagggaggaggcggggggccgggatggagggtcctcgctgggtttcaagcggagctacgaggaacacatcccttacacacacatgaacggaggcaagaaaaacgggcggattctgaccttgcctcggtccaatccttcctaacagtgcctaccgtggcgggggcgggcaggggttcccattttcgctttcctctggtttgaaagcctctggaaaactcaggattctcacgactctaccatgtccagtggagttcagagatcgttcctatacatttctgttcatcttaaggtggactcgtttggttaccaatttaactagtcctgcagaggatttaactgtgaacctggagggcaaggggtttccacagttgctgctcctttggggcaacgacggtttcaaaccaggattttgtgttttttcgttccccccacccgcccccagcagatggaaagaaagcacctgtttttacaaattcttttttttttttttttttttttttttttgctggtgtctgagcttcagtataaaagacaaaacttcctgtttgtggaacaaaatttcgaaagaaaaaaccaaa'
SearchURL: 'https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=M10051'
RetrieveURL: 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&id=186439&rettype=gb&retmode=text&api_key=55022f38eb25e2f6b00a772015c7b77d6208'
This example shows how to retrieve only the coding sequence from chromosome 19 that codes for the human insulin receptor and store it in a structure, CDS. To determine that the coding sequence is positions 139 through 4287, look at the Features field of the returned structure.
CDS = getgenbank('M10051',PartialSeq=[139,4287])CDS = struct with fields:
LocusName: 'HUMINSR'
LocusSequenceLength: '4149'
LocusNumberofStrands: ''
LocusTopology: 'linear'
LocusMoleculeType: 'mRNA'
LocusGenBankDivision: 'PRI'
LocusModificationDate: '06-JAN-1995'
Definition: 'Human insulin receptor mRNA, complete cds.'
Accession: 'M10051 REGION: 139..4287'
Version: 'M10051.1'
GI: ''
Project: []
DBLink: []
Keywords: 'insulin receptor; tyrosine kinase.'
Segment: []
Source: 'Homo sapiens (human)'
SourceOrganism: [4×65 char]
Reference: {[1×1 struct]}
Comment: [14×67 char]
Features: [50×74 char]
CDS: [1×1 struct]
Sequence: 'atgggcaccgggggccggcggggggcggcggccgcgccgctgctggtggcggtggccgcgctgctactgggcgccgcgggccacctgtaccccggagaggtgtgtcccggcatggatatccggaacaacctcactaggttgcatgagctggagaattgctctgtcatcgaaggacacttgcagatactcttgatgttcaaaacgaggcccgaagatttccgagacctcagtttccccaaactcatcatgatcactgattacttgctgctcttccgggtctatgggctcgagagcctgaaggacctgttccccaacctcacggtcatccggggatcacgactgttctttaactacgcgctggtcatcttcgagatggttcacctcaaggaactcggcctctacaacctgatgaacatcacccggggttctgtccgcatcgagaagaacaatgagctctgttacttggccactatcgactggtcccgtatcctggattccgtggaggataatcacatcgtgttgaacaaagatgacaacgaggagtgtggagacatctgtccgggtaccgcgaagggcaagaccaactgccccgccaccgtcatcaacgggcagtttgtcgaacgatgttggactcatagtcactgccagaaagtttgcccgaccatctgtaagtcacacggctgcaccgccgaaggcctctgttgccacagcgagtgcctgggcaactgttctcagcccgacgaccccaccaagtgcgtggcctgccgcaacttctacctggacggcaggtgtgtggagacctgcccgcccccgtactaccacttccaggactggcgctgtgtgaacttcagcttctgccaggacctgcaccacaaatgcaagaactcgcggaggcagggctgccaccaatacgtcattcacaacaacaagtgcatccctgagtgtccctccgggtacacgatgaattccagcaacttgctgtgcaccccatgcctgggtccctgtcccaaggtgtgccacctcctagaaggcgagaagaccatcgactcggtgacgtctgcccaggagctccgaggatgcaccgtcatcaacgggagtctgatcatcaacattcgaggaggcaacaatctggcagctgagctagaagccaacctcggcctcattgaagaaatttcagggtatctaaaaatccgccgatcctacgctctggtgtcactttccttcttccggaagttacgtctgattcgaggagagaccttggaaattgggaactactccttctatgccttggacaaccagaacctaaggcagctctgggactggagcaaacacaacctcaccaccactcaggggaaactcttcttccactataaccccaaactctgcttgtcagaaatccacaagatggaagaagtttcaggaaccaaggggcgccaggagagaaacgacattgccctgaagaccaatggggacaaggcatcctgtgaaaatgagttacttaaattttcttacattcggacatcttttgacaagatcttgctgagatgggagccgtactggccccccgacttccgagacctcttggggttcatgctgttctacaaagaggccccttatcagaatgtgacggagttcgatgggcaggatgcgtgtggttccaacagttggacggtggtagacattgacccacccctgaggtccaacgaccccaaatcacagaaccacccagggtggctgatgcggggtctcaagccctggacccagtatgccatctttgtgaagaccctggtcaccttttcggatgaacgccggacctatggggccaagagtgacatcatttatgtccagacagatgccaccaacccctctgtgcccctggatccaatctcagtgtctaactcatcatcccagattattctgaagtggaaaccaccctccgaccccaatggcaacatcacccactacctggttttctgggagaggcaggcggaagacagtgagctgttcgagctggattattgcctcaaagggctgaagctgccctcgaggacctggtctccaccattcgagtctgaagattctcagaagcacaaccagagtgagtatgaggattcggccggcgaatgctgctcctgtccaaagacagactctcagatcctgaaggagctggaggagtcctcgtttaggaagacgtttgaggattacctgcacaacgtggttttcgtccccagaaaaacctcttcaggcactggtgccgaggaccctaggccatctcggaaacgcaggtcccttggcgatgttgggaatgtgacggtggccgtgcccacggtggcagctttccccaacacttcctcgaccagcgtgcccacgagtccggaggagcacaggccttttgagaaggtggtgaacaaggagtcgctggtcatctccggcttgcgacacttcacgggctatcgcatcgagctgcaggcttgcaaccaggacacccctgaggaacggtgcagtgtggcagcctacgtcagtgcgaggaccatgcctgaagccaaggctgatgacattgttggccctgtgacgcatgaaatctttgagaacaacgtcgtccacttgatgtggcaggagccgaaggagcccaatggtctgatcgtgctgtatgaagtgagttatcggcgatatggtgatgaggagctgcatctctgcgtctcccgcaagcacttcgctctggaacggggctgcaggctgcgtgggctgtcaccggggaactacagcgtgcgaatccgggccacctcccttgcgggcaacggctcttggacggaacccacctatttctacgtgacagactatttagacgtcccgtcaaatattgcaaaaattatcatcggccccctcatctttgtctttctcttcagtgttgtgattggaagtatttatctattcctgagaaagaggcagccagatgggccgctgggaccgctttacgcttcttcaaaccctgagtatctcagtgccagtgatgtgtttccatgctctgtgtacgtgccggacgagtgggaggtgtctcgagagaagatcaccctccttcgagagctggggcagggctccttcggcatggtgtatgagggcaatgccagggacatcatcaagggtgaggcagagacccgcgtggcggtgaagacggtcaacgagtcagccagtctccgagagcggattgagttcctcaatgaggcctcggtcatgaagggcttcacctgccatcacgtggtgcgcctcctgggagtggtgtccaagggccagcccacgctggtggtgatggagctgatggctcacggagacctgaagagctacctccgttctctgcggccagaggctgagaataatcctggccgccctccccctacccttcaagagatgattcagatggcggcagagattgctgacgggatggcctacctgaacgccaagaagtttgtgcatcgggacctggcagcgagaaactgcatggtcgcccatgattttactgtcaaaattggagactttggaatgaccagagacatctatgaaacggattactaccggaaagggggcaagggtctgctccctgtacggtggatggcaccggagtccctgaaggatggggtcttcaccacttcttctgacatgtggtcctttggcgtggtcctttgggaaatcaccagcttggcagaacagccttaccaaggcctgtctaatgaacaggtgttgaaatttgtcatggatggagggtatctggatcaacccgacaactgtccagagagagtcactgacctcatgcgcatgtgctggcaattcaaccccaagatgaggccaaccttcctggagattgtcaacctgctcaaggacgacctgcaccccagctttccagaggtgtcgttcttccacagcgaggagaacaaggctcccgagagtgaggagctggagatggagtttgaggacatggagaatgtgcccctggaccgttcctcgcactgtcagagggaggaggcggggggccgggatggagggtcctcgctgggtttcaagcggagctacgaggaacacatcccttacacacacatgaacggaggcaagaaaaacgggcggattctgaccttgcctcggtccaatccttcctaa'
SearchURL: 'https://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=M10051'
RetrieveURL: 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&id=186439&rettype=gb&retmode=text&api_key=55022f38eb25e2f6b00a772015c7b77d6208&seq_start=139&seq_stop=4287'
Input Arguments
Unique alphanumeric identifier for sequence record, specified as a character vector or string.
Example: 'M10051'
Data Types: char | string
Name-Value Arguments
Specify optional pairs of arguments as
Name1=Value1,...,NameN=ValueN, where Name is
the argument name and Value is the corresponding value.
Name-value arguments must appear after other arguments, but the order of the
pairs does not matter.
Example: PartialSeq=[139,4287]
Two-element array of integers containing the start and end positions of the
subsequence [ that specifies a subsequence to retrieve.
StartBP,
EndBP]StartBP is an integer between 1 and EndBP.
EndBP is an integer between StartBP and
the length of the sequence.
Example: PartialSeq=[139,4287]
GenBank data file name or file path containing the data returned from the GenBank database, specified as a character vector or string. If you specify only a file name, the file is saved to the MATLAB current folder. The function does not append data to an existing file. Instead, it overwrites the contents of the existing file without warning.
Example: ToFile='myFile.m'
Data Types: char | string
Format for sequence information, specified as a character vector or string as:
'GenBank'— Default whenSequenceOnlyisfalse.'FASTA'— Default whenSequenceOnlyistrue.
When 'FileFormat' is 'FASTA', then
Data contains only two fields, Header and
Sequence.
Example: FileFormat='FASTA'
Data Types: char | string
Return only sequence in Data, specified as
false or true. Specify true
to return the sequence.
Connection timeout in seconds, specified as a positive scalar. For more information, see here
Example: TimeOut=6
Data Types: double
Output Arguments
Sequence information, returned as a MATLAB structure.
Version History
Introduced before R2006aThe function no longer appends data to an existing file. The function now overwrites the contents of the existing file without warning.
MATLAB Command
You clicked a link that corresponds to this MATLAB command:
Run the command by entering it in the MATLAB Command Window. Web browsers do not support MATLAB commands.
웹사이트 선택
번역된 콘텐츠를 보고 지역별 이벤트와 혜택을 살펴보려면 웹사이트를 선택하십시오. 현재 계신 지역에 따라 다음 웹사이트를 권장합니다:
또한 다음 목록에서 웹사이트를 선택하실 수도 있습니다.
사이트 성능 최적화 방법
최고의 사이트 성능을 위해 중국 사이트(중국어 또는 영어)를 선택하십시오. 현재 계신 지역에서는 다른 국가의 MathWorks 사이트 방문이 최적화되지 않았습니다.
미주
- América Latina (Español)
- Canada (English)
- United States (English)
유럽
- Belgium (English)
- Denmark (English)
- Deutschland (Deutsch)
- España (Español)
- Finland (English)
- France (Français)
- Ireland (English)
- Italia (Italiano)
- Luxembourg (English)
- Netherlands (English)
- Norway (English)
- Österreich (Deutsch)
- Portugal (English)
- Sweden (English)
- Switzerland
- United Kingdom (English)