Problem 969. Genome Sequence 003: DNA Sequence with random positioned segments

Created by Richard Zapor

Solve Later

{"parts":[{"partUri":"/matlab/document.xml","contentType":"application/vnd.mathworks.matlab.code.document+xml","content":"<?xml version=\"1.0\" encoding=\"UTF-8\"?><w:document xmlns:w=\"http://schemas.openxmlformats.org/wordprocessingml/2006/main\"><w:body><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>This Challenge series will evolve the complexity of Genome DNA Sequencing.</w:t></w:r><w:r><w:t> </w:t></w:r><w:hyperlink w:docLocation=\"\"><w:r><w:t>DNA Sequencing</w:t></w:r></w:hyperlink><w:r><w:t> and the</w:t></w:r><w:r><w:t> </w:t></w:r><w:hyperlink w:docLocation=\"\"><w:r><w:t>Shot Gun Method</w:t></w:r></w:hyperlink><w:r><w:t> will be naively simplified into Cody Challenges.</w:t></w:r><w:r><w:t> </w:t></w:r><w:hyperlink w:docLocation=\"\"><w:r><w:t>Genome sizes</w:t></w:r></w:hyperlink><w:r><w:t> is another interesting wiki page.</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>DNA is represented by symbols ACGT, which for Matlab will be encoded as 0123. The basic goal is to reconstruct the original serial string of ACGT given multiple short segments. Segments are gleaned from multiple copies of the Virus/Bacteria/Chromosome thus there are overlapping, duplicative, and flipped segments. There are potential errors and duplicative stretches in the created segments. Chromosome 20 in its 59,187,298 base pairs has a segment of 820 that is repeated in at least two locations. The data being non-random largely increase lengths of duplicative stretches.</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Example:</w:t></w:r><w:r><w:t> Genome = ACGTCGGCCATGGACATTACG</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Given three overlapping pieces, ACGTCGGCCA,CTACAGGTACCG, and GACATTACG these can be readily seen to overlap and create the original if the middle is recognized as having asymetric overlaps with its adjacent segments.</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"code\"/></w:pPr><w:r><w:t><![CDATA[ACGTCGGCCATGGACATTACG\nACGTCGGCCAsssssssssss\nssssCTACAGGTACCGsssss Middle\nssssssssssssGACATTACG]]></w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Genome_003 Challenge is to reconstruct a genome under near ideal error free segment creation conditions. No segments are reversed. The segments start at random locations.</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Segments start at random positions (Genome_003 change from 001)</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Genome length is unconstrained</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Length of each segment - 48</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>All segments may overlap by 16 to 47 characters</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>No errors in the segments</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Genome is random (No duplicate starts or ends for 16 symbols of segments)</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"ListParagraph\"/><w:numPr><w:numId w:val=\"2\"/></w:numPr><w:jc w:val=\"left\"/></w:pPr><w:r><w:t>Segment order is scrambled</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Input:</w:t></w:r><w:r><w:t> segs, Array of M rows of 48 value segments. Values are [0, 1, 2, 3].</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Output:</w:t></w:r><w:r><w:t> Gout, Genome vector of values [0,1,2,3]</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Example:</w:t></w:r><w:r><w:t> [0 1 2 3 2; 1 2 3 2 2; 2 2 1 1 2] creates [0 1 2 3 2 2 1 1 2] W=5, Overlap=varies</w:t></w:r></w:p><w:p><w:pPr><w:pStyle w:val=\"text\"/><w:jc w:val=\"left\"/></w:pPr><w:r><w:rPr><w:b/></w:rPr><w:t>Future:</w:t></w:r><w:r><w:t> Flipped segments(002), Random Position of Segment start locations(003), Extra Segments, Phage Phi X174, Parallel Processing Simulation(Shot Gun Approach), Haemophilus Influenza, Sequence with Segment Errors, and Chromosome 20 with its 59M length using 100K 4K-segments</w:t></w:r></w:p></w:body></w:document>","relationship":null}],"relationships":[{"relationshipType":"http://schemas.mathworks.com/matlab/code/2013/relationships/document","target":"/matlab/document.xml","relationshipId":"rId1"}]}

<div style = "text-align: start; line-height: 20.4333px; min-height: 0px; white-space: normal; color: rgb(0, 0, 0); font-family: Menlo, Monaco, Consolas, monospace; font-style: normal; font-size: 14px; font-weight: 400; text-decoration: rgb(0, 0, 0); white-space: normal; "><div style="block-size: 706.767px; display: block; min-width: 0px; padding-block-start: 0px; padding-top: 0px; perspective-origin: 407px 353.383px; transform-origin: 407px 353.383px; vertical-align: baseline; "><div style="block-size: 42px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 21px; text-align: left; transform-origin: 384px 21px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 243px 8px; transform-origin: 243px 8px; unicode-bidi: normal; "><span style="">This Challenge series will evolve the complexity of Genome DNA Sequencing.</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 2px 8px; transform-origin: 2px 8px; unicode-bidi: normal; "><span style=""> </span></span><a target='_blank' href = "/#null"><span style=""><span style="">DNA Sequencing</span></span></a><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 26px 8px; transform-origin: 26px 8px; unicode-bidi: normal; "><span style=""> and the</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 2px 8px; transform-origin: 2px 8px; unicode-bidi: normal; "><span style=""> </span></span><a target='_blank' href = "/#null"><span style=""><span style="">Shot Gun Method</span></span></a><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 2px 8px; transform-origin: 2px 8px; unicode-bidi: normal; "><span style=""> will be naively simplified into Cody Challenges.</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 2px 8px; transform-origin: 2px 8px; unicode-bidi: normal; "><span style=""> </span></span><a target='_blank' href = "/#null"><span style=""><span style="">Genome sizes</span></span></a><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 101.5px 8px; transform-origin: 101.5px 8px; unicode-bidi: normal; "><span style=""> is another interesting wiki page.</span></span></div><div style="block-size: 105px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 52.5px; text-align: left; transform-origin: 384px 52.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 369px 8px; transform-origin: 369px 8px; unicode-bidi: normal; "><span style="">DNA is represented by symbols ACGT, which for Matlab will be encoded as 0123. The basic goal is to reconstruct the original serial string of ACGT given multiple short segments. Segments are gleaned from multiple copies of the Virus/Bacteria/Chromosome thus there are overlapping, duplicative, and flipped segments. There are potential errors and duplicative stretches in the created segments. Chromosome 20 in its 59,187,298 base pairs has a segment of 820 that is repeated in at least two locations. The data being non-random largely increase lengths of duplicative stretches.</span></span></div><div style="block-size: 21px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 10.5px; text-align: left; transform-origin: 384px 10.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 31.5px 8px; transform-origin: 31.5px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Example:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 139px 8px; transform-origin: 139px 8px; unicode-bidi: normal; "><span style=""> Genome = ACGTCGGCCATGGACATTACG</span></span></div><div style="block-size: 42px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 21px; text-align: left; transform-origin: 384px 21px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 366.5px 8px; transform-origin: 366.5px 8px; unicode-bidi: normal; "><span style="">Given three overlapping pieces, ACGTCGGCCA,CTACAGGTACCG, and GACATTACG these can be readily seen to overlap and create the original if the middle is recognized as having asymetric overlaps with its adjacent segments.</span></span></div><div style="background-color: rgb(247, 247, 247); block-size: 81.7333px; border-bottom-left-radius: 4px; border-bottom-right-radius: 4px; border-end-end-radius: 4px; border-end-start-radius: 4px; border-start-end-radius: 4px; border-start-start-radius: 4px; border-top-left-radius: 4px; border-top-right-radius: 4px; margin-block-end: 10px; margin-block-start: 10px; margin-bottom: 10px; margin-inline-end: 3px; margin-inline-start: 3px; margin-left: 3px; margin-right: 3px; margin-top: 10px; perspective-origin: 404px 40.8667px; transform-origin: 404px 40.8667px; margin-left: 3px; margin-top: 10px; margin-bottom: 10px; margin-right: 3px; "><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 84px 8.5px; transform-origin: 84px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; ">ACGTCGGCCATGGACATTACG</span></span></div><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 84px 8.5px; transform-origin: 84px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; ">ACGTCGGCCAsssssssssss</span></span></div><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 112px 8.5px; transform-origin: 112px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; perspective-origin: 88px 8.5px; transform-origin: 88px 8.5px; ">ssssCTACAGGTACCGsssss </span><span style="border-block-end-color: rgb(170, 4, 249); border-block-start-color: rgb(170, 4, 249); border-bottom-color: rgb(170, 4, 249); border-inline-end-color: rgb(170, 4, 249); border-inline-start-color: rgb(170, 4, 249); border-left-color: rgb(170, 4, 249); border-right-color: rgb(170, 4, 249); border-top-color: rgb(170, 4, 249); caret-color: rgb(170, 4, 249); color: rgb(170, 4, 249); column-rule-color: rgb(170, 4, 249); margin-inline-end: 0px; margin-right: 0px; outline-color: rgb(170, 4, 249); perspective-origin: 24px 8.5px; text-decoration: none; text-decoration-color: rgb(170, 4, 249); text-emphasis-color: rgb(170, 4, 249); transform-origin: 24px 8.5px; ">Middle</span></span></div><div style="background-color: rgba(0, 0, 0, 0); block-size: 20.4333px; border-bottom-left-radius: 0px; border-bottom-right-radius: 0px; border-end-end-radius: 0px; border-end-start-radius: 0px; border-inline-end-color: rgb(233, 233, 233); border-inline-end-style: solid; border-inline-end-width: 1px; border-inline-start-color: rgb(233, 233, 233); border-inline-start-style: solid; border-inline-start-width: 1px; border-left-color: rgb(233, 233, 233); border-left-style: solid; border-left-width: 1px; border-right-color: rgb(233, 233, 233); border-right-style: solid; border-right-width: 1px; border-start-end-radius: 0px; border-start-start-radius: 0px; border-top-left-radius: 0px; border-top-right-radius: 0px; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; min-block-size: 18px; min-height: 18px; padding-inline-start: 4px; padding-left: 4px; perspective-origin: 404px 10.2167px; transform-origin: 404px 10.2167px; white-space: nowrap; "><span style="block-size: auto; border-inline-end-color: rgb(0, 0, 0); border-inline-end-style: none; border-inline-end-width: 0px; border-inline-start-color: rgb(0, 0, 0); border-inline-start-style: none; border-inline-start-width: 0px; border-left-color: rgb(0, 0, 0); border-left-style: none; border-left-width: 0px; border-right-color: rgb(0, 0, 0); border-right-style: none; border-right-width: 0px; display: inline; margin-inline-end: 45px; margin-right: 45px; min-block-size: 0px; min-height: 0px; padding-inline-start: 0px; padding-left: 0px; perspective-origin: 84px 8.5px; transform-origin: 84px 8.5px; unicode-bidi: normal; white-space: pre; margin-right: 45px; "><span style="margin-inline-end: 0px; margin-right: 0px; ">ssssssssssssGACATTACG</span></span></div></div><div style="block-size: 42px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 10px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 10px; perspective-origin: 384px 21px; text-align: left; transform-origin: 384px 21px; white-space: pre-wrap; margin-left: 4px; margin-top: 10px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 354px 8px; transform-origin: 354px 8px; unicode-bidi: normal; "><span style="">Genome_003 Challenge is to reconstruct a genome under near ideal error free segment creation conditions. No segments are reversed. The segments start at random locations.</span></span></div><ol style="block-size: 143.033px; counter-reset: list-item 0; font-family: Helvetica, Arial, sans-serif; list-style-type: decimal; margin-block-end: 20px; margin-block-start: 10px; margin-bottom: 20px; margin-top: 10px; perspective-origin: 391px 71.5167px; transform-origin: 391px 71.5167px; margin-top: 10px; margin-bottom: 20px; "><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 217px 8px; transform-origin: 217px 8px; unicode-bidi: normal; "><span style="">Segments start at random positions (Genome_003 change from 001)</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 102.5px 8px; transform-origin: 102.5px 8px; unicode-bidi: normal; "><span style="">Genome length is unconstrained</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 91px 8px; transform-origin: 91px 8px; unicode-bidi: normal; "><span style="">Length of each segment - 48</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 153.5px 8px; transform-origin: 153.5px 8px; unicode-bidi: normal; "><span style="">All segments may overlap by 16 to 47 characters</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 81.5px 8px; transform-origin: 81.5px 8px; unicode-bidi: normal; "><span style="">No errors in the segments</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 240px 8px; transform-origin: 240px 8px; unicode-bidi: normal; "><span style="">Genome is random (No duplicate starts or ends for 16 symbols of segments)</span></span></li><li style="block-size: 20.4333px; counter-reset: none; display: list-item; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-start: 56px; margin-left: 56px; margin-top: 0px; perspective-origin: 363px 10.2167px; text-align: left; transform-origin: 363px 10.2167px; white-space: pre-wrap; margin-left: 56px; "><span style="block-size: auto; display: inline; margin-inline-start: 0px; margin-left: 0px; perspective-origin: 88.5px 8px; transform-origin: 88.5px 8px; unicode-bidi: normal; "><span style="">Segment order is scrambled</span></span></li></ol><div style="block-size: 21px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 10.5px; text-align: left; transform-origin: 384px 10.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 20px 8px; transform-origin: 20px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Input:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 213px 8px; transform-origin: 213px 8px; unicode-bidi: normal; "><span style=""> segs, Array of M rows of 48 value segments. Values are [0, 1, 2, 3].</span></span></div><div style="block-size: 21px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 10.5px; text-align: left; transform-origin: 384px 10.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 26px 8px; transform-origin: 26px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Output:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 128.5px 8px; transform-origin: 128.5px 8px; unicode-bidi: normal; "><span style=""> Gout, Genome vector of values [0,1,2,3]</span></span></div><div style="block-size: 21px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 10.5px; text-align: left; transform-origin: 384px 10.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 31.5px 8px; transform-origin: 31.5px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Example:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 250px 8px; transform-origin: 250px 8px; unicode-bidi: normal; "><span style=""> [0 1 2 3 2; 1 2 3 2 2; 2 2 1 1 2] creates [0 1 2 3 2 2 1 1 2] W=5, Overlap=varies</span></span></div><div style="block-size: 63px; font-family: Helvetica, Arial, sans-serif; line-height: 21px; margin-block-end: 9px; margin-block-start: 2px; margin-bottom: 9px; margin-inline-end: 10px; margin-inline-start: 4px; margin-left: 4px; margin-right: 10px; margin-top: 2px; perspective-origin: 384px 31.5px; text-align: left; transform-origin: 384px 31.5px; white-space: pre-wrap; margin-left: 4px; margin-top: 2px; margin-bottom: 9px; margin-right: 10px; "><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 25.5px 8px; transform-origin: 25.5px 8px; unicode-bidi: normal; "><span style="font-weight: 700; ">Future:</span></span><span style="block-size: auto; display: inline; margin-block-end: 0px; margin-block-start: 0px; margin-bottom: 0px; margin-inline-end: 0px; margin-inline-start: 0px; margin-left: 0px; margin-right: 0px; margin-top: 0px; perspective-origin: 345.5px 8px; transform-origin: 345.5px 8px; unicode-bidi: normal; "><span style=""> Flipped segments(002), Random Position of Segment start locations(003), Extra Segments, Phage Phi X174, Parallel Processing Simulation(Shot Gun Approach), Haemophilus Influenza, Sequence with Segment Errors, and Chromosome 20 with its 59M length using 100K 4K-segments</span></span></div></div></div>

This Challenge series will evolve the complexity of Genome DNA Sequencing. DNA Sequencing and the Shot Gun Method will be naively simplified into Cody Challenges. Genome sizes is another interesting wiki page.
DNA is represented by symbols ACGT, which for Matlab will be encoded as 0123. The basic goal is to reconstruct the original serial string of ACGT given multiple short segments. Segments are gleaned from multiple copies of the Virus/Bacteria/Chromosome thus there are overlapping, duplicative, and flipped segments. There are potential errors and duplicative stretches in the created segments. Chromosome 20 in its 59,187,298 base pairs has a segment of 820 that is repeated in at least two locations. The data being non-random largely increase lengths of duplicative stretches.
Example: Genome = ACGTCGGCCATGGACATTACG
Given three overlapping pieces, ACGTCGGCCA,CTACAGGTACCG, and GACATTACG these can be readily seen to overlap and create the original if the middle is recognized as having asymetric overlaps with its adjacent segments.
ACGTCGGCCATGGACATTACG
ACGTCGGCCAsssssssssss
ssssCTACAGGTACCGsssss Middle
ssssssssssssGACATTACG
Genome_003 Challenge is to reconstruct a genome under near ideal error free segment creation conditions. No segments are reversed. The segments start at random locations.
Segments start at random positions (Genome_003 change from 001)
Genome length is unconstrained
Length of each segment - 48
All segments may overlap by 16 to 47 characters
No errors in the segments
Genome is random (No duplicate starts or ends for 16 symbols of segments)
Segment order is scrambled
Input: segs, Array of M rows of 48 value segments. Values are [0, 1, 2, 3].
Output: Gout, Genome vector of values [0,1,2,3]
Example: [0 1 2 3 2; 1 2 3 2 2; 2 2 1 1 2] creates [0 1 2 3 2 2 1 1 2] W=5, Overlap=varies
Future: Flipped segments(002), Random Position of Segment start locations(003), Extra Segments, Phage Phi X174, Parallel Processing Simulation(Shot Gun Approach), Haemophilus Influenza, Sequence with Segment Errors, and Chromosome 20 with its 59M length using 100K 4K-segments

Solve

Solution Stats

10 Solutions
3 Solvers

Last Solution submitted on Jul 19, 2021

Last 200 Solutions

Problem Comments

1 Comment

1 Comment

Are Mjaavatten on 19 Jul 2021

This is the hardest of the four sequencing problems by @Richard Zapor

Solution Comments

Show comments

Problem Recent Solvers3

Problem Tags

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!

Problem 969. Genome Sequence 003: DNA Sequence with random positioned segments

Solution Stats

Last 200 Solutions

Problem Comments

Solution Comments

Problem Recent Solvers3

Suggested Problems

More from this Author293

Problem Tags

Community Treasure Hunt

Problem 969. Genome Sequence 003: DNA Sequence with random positioned segments

Solution Stats

Last 200 Solutions

Problem Comments

Solution Comments

Problem Recent Solvers3

Suggested Problems

More from this Author293

Problem Tags

Community Treasure Hunt

Players