이 페이지의 최신 내용은 아직 번역되지 않았습니다. 최신 내용은 영문으로 볼 수 있습니다.

텍스트와 문자

string형 배열의 텍스트

텍스트를 사용하여 작업할 때는 문자 시퀀스를 큰따옴표로 묶습니다. 텍스트를 변수에 할당할 수 있습니다.

t = "Hello, world";

텍스트에 큰따옴표가 포함되어 있는 경우에는 정의할 때 두 개의 큰따옴표를 사용하십시오.

q = "Something ""quoted"" and something else."
q = 

    "Something "quoted" and something else."

tq는 다른 모든 MATLAB® 변수와 마찬가지로 배열입니다. 클래스 또는 데이터형은 string입니다.

whos t
  Name        Size            Bytes  Class     Attributes
  t           1x1               174  string   

참고

큰따옴표를 사용하여 string형 배열을 만드는 방법은 R2017a에서 추가되었습니다. 이전 릴리스를 사용 중인 경우에는 문자형 배열을 만드십시오. 자세한 내용은 문자형 배열의 데이터 항목을 참조하십시오.

문자열 끝에 텍스트를 추가하려면 플러스 연산자 +를 사용하십시오.

f = 71;
c = (f-32)/1.8;
tempText = "Temperature is " + c + "C"
tempText = 
"Temperature is 21.6667C"

숫자형 배열과 마찬가지로, string형 배열은 여러 개의 요소를 가질 수 있습니다. strlength 함수를 사용하여 배열 내 각 string형의 길이를 구할 수 있습니다.

A = ["a","bb","ccc"; "dddd","eeeeee","fffffff"]
A = 
  2×3 string array
    "a"       "bb"        "ccc"    
    "dddd"    "eeeeee"    "fffffff"
strlength(A)
ans =

     1     2     3
     4     6     7

문자형 배열의 데이터

때로는 DNA 염기 서열처럼 문자가 텍스트에 해당하지 않는 데이터를 나타낼 수 있습니다. 이러한 유형의 데이터는 데이터형 char을 갖는 문자형 배열에 저장할 수 있습니다. 문자형 배열은 작은따옴표를 사용합니다.

seq = 'GCTAGAATCC';
whos seq
  Name      Size            Bytes  Class    Attributes
  seq       1x10               20  char               

배열의 각 요소에는 단일 문자가 포함됩니다.

seq(4)
ans = 
    'A'

숫자형 배열을 결합하는 경우와 마찬가지로 문자형 배열을 대괄호로 결합할 수 있습니다.

seq2 = [seq 'ATTAGAAACC']
seq2 =
    'GCTAGAATCCATTAGAAACC'

문자형 배열은 string형 배열이 도입되기 전에 작성된 프로그램에 일반적으로 사용됩니다. string형 데이터를 받는 모든 MATLAB 함수는 char형 데이터도 받으며 그 반대의 경우도 마찬가지입니다.