Cody

Problem 79. DNA N-Gram Distribution

Solution 2614885

Submitted on 26 Jun 2020 by 春樹 内糸
This solution is locked. To view this solution, you need to provide a solution of the same size or smaller.

Test Suite

Test Status Code Input and Output
1   Pass
s = 'AACTGAACG'; n = 3; hifreq_correct = 'AAC'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

cnt = Map with properties: Count: 0 KeyType: char ValueType: any str = 'AAC' cnt = Map with properties: Count: 1 KeyType: char ValueType: any cnt = Map with properties: Count: 1 KeyType: char ValueType: any str = 'ACT' cnt = Map with properties: Count: 2 KeyType: char ValueType: any cnt = Map with properties: Count: 2 KeyType: char ValueType: any str = 'CTG' cnt = Map with properties: Count: 3 KeyType: char ValueType: any cnt = Map with properties: Count: 3 KeyType: char ValueType: any str = 'TGA' cnt = Map with properties: Count: 4 KeyType: char ValueType: any cnt = Map with properties: Count: 4 KeyType: char ValueType: any str = 'GAA' cnt = Map with properties: Count: 5 KeyType: char ValueType: any cnt = Map with properties: Count: 5 KeyType: char ValueType: any str = 'AAC' cnt = Map with properties: Count: 5 KeyType: char ValueType: any str = 'ACG' cnt = Map with properties: Count: 6 KeyType: char ValueType: any cnt = Map with properties: Count: 6 KeyType: char ValueType: any vs = 2 1 1 1 1 1 M = 2 I = 1 ks = 1×6 cell array {'AAC'} {'ACG'} {'ACT'} {'CTG'} {'GAA'} {'TGA'} ksc = 1×1 cell array {'AAC'} hifreq = 'AAC'

2   Pass
s = 'dynamic routing service'; n = 2; hifreq_correct = 'ic'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

cnt = Map with properties: Count: 0 KeyType: char ValueType: any str = 'dy' cnt = Map with properties: Count: 1 KeyType: char ValueType: any cnt = Map with properties: Count: 1 KeyType: char ValueType: any str = 'yn' cnt = Map with properties: Count: 2 KeyType: char ValueType: any cnt = Map with properties: Count: 2 KeyType: char ValueType: any str = 'na' cnt = Map with properties: Count: 3 KeyType: char ValueType: any cnt = Map with properties: Count: 3 KeyType: char ValueType: any str = 'am' cnt = Map with properties: Count: 4 KeyType: char ValueType: any cnt = Map with properties: Count: 4 KeyType: char ValueType: any str = 'mi' cnt = Map with properties: Count: 5 KeyType: char ValueType: any cnt = Map with properties: Count: 5 KeyType: char ValueType: any str = 'ic' cnt = Map with properties: Count: 6 KeyType: char ValueType: any cnt = Map with properties: Count: 6 KeyType: char ValueType: any str = 'c ' cnt = Map with properties: Count: 7 KeyType: char ValueType: any cnt = Map with properties: Count: 7 KeyType: char ValueType: any str = ' r' cnt = Map with properties: Count: 8 KeyType: char ValueType: any cnt = Map with properties: Count: 8 KeyType: char ValueType: any str = 'ro' cnt = Map with properties: Count: 9 KeyType: char ValueType: any cnt = Map with properties: Count: 9 KeyType: char ValueType: any str = 'ou' cnt = Map with properties: Count: 10 KeyType: char ValueType: any cnt = Map with properties: Count: 10 KeyType: char ValueType: any str = 'ut' cnt = Map with properties: Count: 11 KeyType: char ValueType: any cnt = Map with properties: Count: 11 KeyType: char ValueType: any str = 'ti' cnt = Map with properties: Count: 12 KeyType: char ValueType: any cnt = Map with properties: Count: 12 KeyType: char ValueType: any str = 'in' cnt = Map with properties: Count: 13 KeyType: char ValueType: any cnt = Map with properties: Count: 13 KeyType: char ValueType: any str = 'ng' cnt = Map with properties: Count: 14 KeyType: char ValueType: any cnt = Map with properties: Count: 14 KeyType: char ValueType: any str = 'g ' cnt = Map with properties: Count: 15 KeyType: char ValueType: any cnt = Map with properties: Count: 15 KeyType: char ValueType: any str = ' s' cnt = Map with properties: Count: 16 KeyType: char ValueType: any cnt = Map with properties: Count: 16 KeyType: char ValueType: any str = 'se' cnt = Map with properties: Count: 17 KeyType: char ValueType: any cnt = Map with properties: Count: 17 KeyType: char ValueType: any str = 'er' cnt = Map with properties: Count: 18 KeyType: char ValueType: any cnt = Map with properties: Count: 18 KeyType: char ValueType: any str = 'rv' cnt = Map with properties: Count: 19 KeyType: char ValueType: any cnt = Map with properties: Count: 19 KeyType: char ValueType: any str = 'vi' cnt = Map with properties: Count: 20 KeyType: char ValueType: any cnt = Map with properties: Count: 20 KeyType: char ValueType: any str = 'ic' cnt = Map with properties: Count: 20 KeyType: char ValueType: any str = 'ce' cnt = Map with properties: Count: 21 KeyType: char ValueType: any cnt = Map with properties: Count: 21 KeyType: char ValueType: any vs = 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 M = 2 I = 9 ks = 1×21 cell array Columns 1 through 18 {' r'} {' s'} {'am'} {'c '} {'ce'} {'dy'} {'er'} {'g '} {'ic'} {'in'} {'mi'} {'na'} {'ng'} {'ou'} {'ro'} {'rv'} {'se'} {'ti'} Columns 19 through 21 {'ut'} {'vi'} {'yn'} ksc = 1×1 cell array {'ic'} hifreq = 'ic'

3   Pass
s = 'Your veracity is exceeded by your sagacity.'; n = 5; hifreq_correct = 'acity'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

cnt = Map with properties: Count: 0 KeyType: char ValueType: any str = 'Your ' cnt = Map with properties: Count: 1 KeyType: char ValueType: any cnt = Map with properties: Count: 1 KeyType: char ValueType: any str = 'our v' cnt = Map with properties: Count: 2 KeyType: char ValueType: any cnt = Map with properties: Count: 2 KeyType: char ValueType: any str = 'ur ve' cnt = Map with properties: Count: 3 KeyType: char ValueType: any cnt = Map with properties: Count: 3 KeyType: char ValueType: any str = 'r ver' cnt = Map with properties: Count: 4 KeyType: char ValueType: any cnt = Map with properties: Count: 4 KeyType: char ValueType: any str = ' vera' cnt = Map with properties: Count: 5 KeyType: char ValueType: any cnt = Map with properties: Count: 5 KeyType: char ValueType: any str = 'verac' cnt = Map with properties: Count: 6 KeyType: char ValueType: any cnt = Map with properties: Count: 6 KeyType: char ValueType: any str = 'eraci' cnt = Map with properties: Count: 7 KeyType: char ValueType: any cnt = Map with properties: Count: 7 KeyType: char ValueType: any str = 'racit' cnt = Map with properties: Count: 8 KeyType: char ValueType: any cnt = Map with properties: Count: 8 KeyType: char ValueType: any str = 'acity' cnt = Map with properties: Count: 9 KeyType: char ValueType: any cnt = Map with properties: Count: 9 KeyType: char ValueType: any str = 'city ' cnt = Map with properties: Count: 10 KeyType: char ValueType: any cnt = Map with properties: Count: 10 KeyType: char ValueType: any str = 'ity i' cnt = Map with properties: Count: 11 KeyType: char ValueType: any cnt = Map with properties: Count: 11 KeyType: char ValueType: any str = 'ty is' cnt = Map with properties: Count: 12 KeyType: char ValueType: any cnt = Map with properties: Count: 12 KeyType: char ValueType: any str = 'y is ' cnt = Map with properties: Count: 13 KeyType: char ValueType: any cnt = Map with properties: Count: 13 KeyType: char ValueType: any str = ' is e' cnt = Map with properties: Count: 14 KeyType: char ValueType: any cnt = Map with properties: Count: 14 KeyType: char ValueType: any str = 'is ex' cnt = Map with properties: Count: 15 KeyType: char ValueType: any cnt = Map with properties: Count: 15 KeyType: char ValueType: any str = 's exc' cnt = Map with properties: Count: 16 KeyType: char ValueType: any cnt = Map with properties: Count: 16 KeyType: char ValueType: any str = ' exce' cnt = Map with properties: Count: 17 KeyType: char ValueType: any cnt = Map with properties: Count: 17 KeyType: char ValueType: any str = 'excee' cnt = Map with properties: Count: 18 KeyType: char ValueType: any cnt = Map with properties: Count: 18 KeyType: char ValueType: any str = 'xceed' cnt = Map with properties: Count: 19 KeyType: char ValueType: any cnt = Map with properties: Count: 19 KeyType: char ValueType: any str = 'ceede' cnt = Map with properties: Count: 20 KeyType: char ValueType: any cnt = Map with properties: Count: 20 KeyType: char ValueType: any str = 'eeded' cnt = Map with properties: Count: 21 KeyType: char ValueType: any cnt = Map with properties: Count: 21 KeyType: char ValueType: any str = 'eded ' cnt = Map with properties: Count: 22 KeyType: char ValueType: any cnt = Map with properties: Count: 22 KeyType: char ValueType: any str = 'ded b' cnt = Map with properties: Count: 23 KeyType: char ValueType: any cnt = Map with properties: Count: 23 KeyType: char ValueType: any str = 'ed by' cnt = Map with properties: Count: 24 KeyType: char ValueType: any cnt = Map with properties: Count: 24 KeyType: char ValueType: any str = 'd by ' cnt = Map with properties: Count: 25 KeyType: char ValueType: any cnt = Map with properties: Count: 25 KeyType: char ValueType: any str = ' by y' cnt = Map with properties: Count: 26 KeyType: char ValueType: any cnt = Map with properties: Count: 26 KeyType: char ValueType: any str = 'by yo' cnt = Map with properties: Count: 27 KeyType: char ValueType: any cnt = Map with properties: Count: 27 KeyType: char ValueType: any str = 'y you' cnt = Map with properties: Count: 28 KeyType: char ValueType: any cnt = Map with properties: Count: 28 KeyType: char ValueType: any str = ' your' cnt = Map with properties: Count: 29 KeyType: char ValueType: any cnt = Map with properties: Count: 29 KeyType: char ValueType: any str = 'your ' cnt = Map with properties: Count: 30 KeyType: char ValueType: any cnt = Map with properties: Count: 30 KeyType: char ValueType: any str = 'our s' cnt = Map with properties: Count: 31 KeyType: char ValueType: any cnt = Map with properties: Count: 31 KeyType: char ValueType: any str = 'ur sa' cnt = Map with properties: Count: 32 KeyType: char ValueType: any cnt = Map with properties: Count: 32 KeyType: char ValueType: any str = 'r sag' cnt = Map with properties: Count: 33 KeyType: char ValueType: any cnt = Map with properties: Count: 33 KeyType: char ValueType: any str = ' saga' cnt = Map with properties: Count: 34 KeyType: char ValueType: any cnt = Map with properties: Count: 34 KeyType: char ValueType: any str = 'sagac' cnt = Map with properties: Count: 35 KeyType: char ValueType: any cnt = Map with properties: Count: 35 KeyType: char ValueType: any str = 'agaci' cnt = Map with properties: Count: 36 KeyType: char ValueType: any cnt = Map with properties: Count: 36 KeyType: char ValueType: any str = 'gacit' cnt = Map with properties: Count: 37 KeyType: char ValueType: any cnt = Map with properties: Count: 37 KeyType: char ValueType: any str = 'acity' cnt = Map with properties: Count: 37 KeyType: char ValueType: any str = 'city.' cnt = Map with properties: Count: 38 KeyType: char ValueType: any cnt = Map with properties: Count: 38 KeyType: char ValueType: any vs = Columns 1 through 30 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Columns 31 through 38 1 1 1 1 1 1 1 1 M = 2 I = 8 ks = 1×38 cell array Columns 1 through 13 {' by y'} {' exce'} {' is e'} {' saga'} {' vera'} {' your'} {'Your '} {'acity'} {'agaci'} {'by yo'} {'ceede'} {'city '} {'city.'} Columns 14 through 26 {'d by '} {'ded b'} {'ed by'} {'eded '} {'eeded'} {'eraci'} {'excee'} {'gacit'} {'is ex'} {'ity i'} {'our s'} {'our v'} {'r sag'} Columns 27 through 38 {'r ver'} {'racit'} {'s exc'} {'sagac'} {'ty is'} {'ur sa'} {'ur ve'} {'verac'} {'xceed'} {'y is '} {'y you'} {'your '} ksc = 1×1 cell array {'acity'} hifreq = 'acity'

4   Pass
s = 'AGCGAAGGAAGGATCACATTTCTCAGGACAAAGGCATTTCACTAATGGTT'; n = 3; hifreq_correct = 'AGG'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

cnt = Map with properties: Count: 0 KeyType: char ValueType: any str = 'AGC' cnt = Map with properties: Count: 1 KeyType: char ValueType: any cnt = Map with properties: Count: 1 KeyType: char ValueType: any str = 'GCG' cnt = Map with properties: Count: 2 KeyType: char ValueType: any cnt = Map with properties: Count: 2 KeyType: char ValueType: any str = 'CGA' cnt = Map with properties: Count: 3 KeyType: char ValueType: any cnt = Map with properties: Count: 3 KeyType: char ValueType: any str = 'GAA' cnt = Map with properties: Count: 4 KeyType: char ValueType: any cnt = Map with properties: Count: 4 KeyType: char ValueType: any str = 'AAG' cnt = Map with properties: Count: 5 KeyType: char ValueType: any cnt = Map with properties: Count: 5 KeyType: char ValueType: any str = 'AGG' cnt = Map with properties: Count: 6 KeyType: char ValueType: any cnt = Map with properties: Count: 6 KeyType: char ValueType: any str = 'GGA' cnt = Map with properties: Count: 7 KeyType: char ValueType: any cnt = Map with properties: Count: 7 KeyType: char ValueType: any str = 'GAA' cnt = Map with properties: Count: 7 KeyType: char ValueType: any str = 'AAG' cnt = Map with properties: Count: 7 KeyType: char ValueType: any str = 'AGG' cnt = Map with properties: Count: 7 KeyType: char ValueType: any str = 'GGA' cnt = Map with properties: Count: 7 KeyType: char ValueType: any str = 'GAT' cnt = Map with properties: Count: 8 KeyType: char ValueType: any cnt = Map with properties: Count: 8 KeyType: char ValueType: any str = 'ATC' cnt = Map with properties: Count: 9 KeyType: char ValueType: any cnt = Map with properties: Count: 9 KeyType: char ValueType: any str = 'TCA' cnt = Map with properties: Count: 10 KeyType: char ValueType: any cnt = Map with properties: Count: 10 KeyType: char ValueType: any str = 'CAC' cnt = Map with properties: Count: 11 KeyType: char ValueType: any cnt = Map with properties: Count: 11 KeyType: char ValueType: any str = 'ACA' cnt = Map with properties: Count: 12 KeyType: char ValueType: any cnt = Map with properties: Count: 12 KeyType: char ValueType: any str = 'CAT' cnt = Map with properties: Count: 13 KeyType: char ValueType: any cnt = Map with properties: Count: 13 KeyType: char ValueType: any str = 'ATT' cnt = Map with properties: Count: 14 KeyType: char ValueType: any cnt = Map with properties: Count: 14 KeyType: char ValueType: any str = 'TTT' cnt = Map with properties: Count: 15 KeyType: char ValueType: any cnt = Map with properties: Count: 15 KeyType: char ValueType: any str = 'TTC' cnt = Map with properties: Count: 16 KeyType: char ValueType: any cnt = Map with properties: Count: 16 KeyType: char ValueType: any str = 'TCT' cnt = Map with properties: Count: 17 KeyType: char ValueType: any cnt = Map with properties: Count: 17 KeyType: char ValueType: any str = 'CTC' cnt = Map with properties: Count: 18 KeyType: char ValueType: any cnt = Map with properties: Count: 18 KeyType: char ValueType: any str = 'TCA' cnt = Map with properties: Count: 18 KeyType: char ValueType: any str = 'CAG' cnt = Map with properties: Count: 19 KeyType: char ValueType: any cnt = Map with properties: Count: 19 KeyType: char ValueType: any str = 'AGG' cnt = Map with properties: Count: 19 KeyType: char ValueType: any str = 'GGA' cnt = Map with properties: Count: 19 KeyType: char ValueType: any str = 'GAC' cnt = Map with properties: Count: 20 KeyType: char ValueType: any cnt = Map with properties: Count: 20 KeyType: char ValueType: any str = 'ACA' cnt = Map with properties: Count: 20 KeyType: char ValueType: any str = 'CAA' cnt = Map with properties: Count: 21 KeyType: char ValueType: any cnt = Map with properties: Count: 21 KeyType: char ValueType: any str = 'AAA' cnt = Map with properties: Count: 22 KeyType: char ValueType: any cnt = Map with properties: Count: 22 KeyType: char ValueType: any str = 'AAG' cnt = Map with properties: Count: 22 KeyType: char ValueType: any str = 'AGG' cnt = Map with properties: Count: 22 KeyType: char ValueType: any str = 'GGC' cnt = Map with properties: Count: 23 KeyType: char ValueType: any cnt = Map with properties: Count: 23 KeyType: char ValueType: any str = 'GCA' cnt = Map with properties: Count: 24 KeyType: char ValueType: any cnt = Map with properties: Count: 24 KeyType: char ValueType: any str = 'CAT' cnt = Map with properties: Count: 24 KeyType: char ValueType: any str = 'ATT' cnt = Map with properties: Count: 24 KeyType: char ValueType: any str = 'TTT' cnt = Map with properties: Count: 24 KeyType: char ValueType: any str = 'TTC' cnt = Map with properties: Count: 24 KeyType: char ValueType: any str = 'TCA' cnt = Map with properties: Count: 24 KeyType: char ValueType: any str = 'CAC' cnt = Map with properties: Count: 24 KeyType: char ValueType: any str = 'ACT' cnt = Map with properties: Count: 25 KeyType: char ValueType: any cnt = Map with properties: Count: 25 KeyType: char ValueType: any str = 'CTA' cnt = Map with properties: Count: 26 KeyType: char ValueType: any cnt = Map with properties: Count: 26 KeyType: char ValueType: any str = 'TAA' cnt = Map with properties: Count: 27 KeyType: char ValueType: any cnt = Map with properties: Count: 27 KeyType: char ValueType: any str = 'AAT' cnt = Map with properties: Count: 28 KeyType: char ValueType: any cnt = Map with properties: Count: 28 KeyType: char ValueType: any str = 'ATG' cnt = Map with properties: Count: 29 KeyType: char ValueType: any cnt = Map with properties: Count: 29 KeyType: char ValueType: any str = 'TGG' cnt = Map with properties: Count: 30 KeyType: char ValueType: any cnt = Map with properties: Count: 30 KeyType: char ValueType: any str = 'GGT' cnt = Map with properties: Count: 31 KeyType: char ValueType: any cnt = Map with properties: Count: 31 KeyType: char ValueType: any str = 'GTT' cnt = Map with properties: Count: 32 KeyType: char ValueType: any cnt = Map with properties: Count: 32 KeyType: char ValueType: any vs = Columns 1 through 30 1 3 1 2 1 1 4 1 1 2 1 2 1 2 1 1 1 2 1 1 1 1 3 1 1 1 1 3 1 1 Columns 31 through 32 2 2 M = 4 I = 7 ks = 1×32 cell array Columns 1 through 16 {'AAA'} {'AAG'} {'AAT'} {'ACA'} {'ACT'} {'AGC'} {'AGG'} {'ATC'} {'ATG'} {'ATT'} {'CAA'} {'CAC'} {'CAG'} {'CAT'} {'CGA'} {'CTA'} Columns 17 through 32 {'CTC'} {'GAA'} {'GAC'} {'GAT'} {'GCA'} {'GCG'} {'GGA'} {'GGC'} {'GGT'} {'GTT'} {'TAA'} {'TCA'} {'TCT'} {'TGG'} {'TTC'} {'TTT'} ksc = 1×1 cell array {'AGG'} hifreq = 'AGG'

5   Pass
s = 'In short, in matters vegetable, animal, and mineral, I am the very model of a modern Major-General.'; n = 2; hifreq_correct = 'er'; assert(isequal(nGramFrequency(s,n),hifreq_correct))

cnt = Map with properties: Count: 0 KeyType: char ValueType: any str = 'In' cnt = Map with properties: Count: 1 KeyType: char ValueType: any cnt = Map with properties: Count: 1 KeyType: char ValueType: any str = 'n ' cnt = Map with properties: Count: 2 KeyType: char ValueType: any cnt = Map with properties: Count: 2 KeyType: char ValueType: any str = ' s' cnt = Map with properties: Count: 3 KeyType: char ValueType: any cnt = Map with properties: Count: 3 KeyType: char ValueType: any str = 'sh' cnt = Map with properties: Count: 4 KeyType: char ValueType: any cnt = Map with properties: Count: 4 KeyType: char ValueType: any str = 'ho' cnt = Map with properties: Count: 5 KeyType: char ValueType: any cnt = Map with properties: Count: 5 KeyType: char ValueType: any str = 'or' cnt = Map with properties: Count: 6 KeyType: char ValueType: any cnt = Map with properties: Count: 6 KeyType: char ValueType: any str = 'rt' cnt = Map with properties: Count: 7 KeyType: char ValueType: any cnt = Map with properties: Count: 7 KeyType: char ValueType: any str = 't,' cnt = Map with properties: Count: 8 KeyType: char ValueType: any cnt = Map with properties: Count: 8 KeyType: char ValueType: any str = ', ' cnt = Map with properties: Count: 9 KeyType: char ValueType: any cnt = Map with properties: Count: 9 KeyType: char ValueType: any str = ' i' cnt = Map with properties: Count: 10 KeyType: char ValueType: any cnt = Map with properties: Count: 10 KeyType: char ValueType: any str = 'in' cnt = Map with properties: Count: 11 KeyType: char ValueType: any cnt = Map with properties: Count: 11 KeyType: char ValueType: any str = 'n ' cnt = Map with properties: Count: 11 KeyType: char ValueType: any str = ' m' cnt = Map with properties: Count: 12 KeyType: char ValueType: any cnt = Map with properties: Count: 12 KeyType: char ValueType: any str = 'ma' cnt = Map with properties: Count: 13 KeyType: char ValueType: any cnt = Map with properties: Count: 13 KeyType: char ValueType: any str = 'at' cnt = Map with properties: Count: 14 KeyType: char ValueType: any cnt = Map with properties: Count: 14 KeyType: char ValueType: any str = 'tt' cnt = Map with properties: Count: 15 KeyType: char ValueType: any cnt = Map with properties: Count: 15 KeyType: char ValueType: any str = 'te' cnt = Map with properties: Count: 16 KeyType: char ValueType: any cnt = Map with properties: Count: 16 KeyType: char ValueType: any str = 'er' cnt = Map with properties: Count: 17 KeyType: char ValueType: any cnt = Map with properties: Count: 17 KeyType: char ValueType: any str = 'rs' cnt = Map with properties: Count: 18 KeyType: char ValueType: any cnt = Map with properties: Count: 18 KeyType: char ValueType: any str = 's ' cnt = Map with properties: Count: 19 KeyType: char ValueType: any cnt = Map with properties: Count: 19 KeyType: char ValueType: any str = ' v' cnt = Map with properties: Count: 20 KeyType: char ValueType: any cnt = Map with properties: Count: 20 KeyType: char ValueType: any str = 've' cnt = Map with properties: Count: 21 KeyType: char ValueType: any cnt = Map with properties: Count: 21 KeyType: char ValueType: any str = 'eg' cnt = Map with properties: Count: 22 KeyType: char ValueType: any cnt = Map with properties: Count: 22 KeyType: char ValueType: any str = 'ge' cnt = Map with properties: Count: 23 KeyType: char ValueType: any cnt = Map with properties: Count: 23 KeyType: char ValueType: any str = 'et' cnt = Map with properties: Count: 24 KeyType: char ValueType: any cnt = Map with properties: Count: 24 KeyType: char ValueType: any str = 'ta' cnt = Map with properties: Count: 25 KeyType: char ValueType: any cnt = Map with properties: Count: 25 KeyType: char ValueType: any str = 'ab' cnt = Map with properties: Count: 26 KeyType: char ValueType: any cnt = Map with properties: Count: 26 KeyType: char ValueType: any str = 'bl' cnt = Map with properties: Count: 27 KeyType: char ValueType: any cnt = Map with properties: Count: 27 KeyType: char ValueType: any str = 'le' cnt = Map with properties: Count: 28 KeyType: char ValueType: any cnt = Map with properties: Count: 28 KeyType: char ValueType: any str = 'e,' cnt = Map with properties: Count: 29 KeyType: char ValueType: any cnt = Map with properties: Count: 29 KeyType: char ValueType: any str = ', ' cnt = Map with properties: Count: 29 KeyType: char ValueType: any str = ' a' cnt = Map with properties: Count: 30 KeyType: char ValueType: any cnt = Map with properties: Count: 30 KeyType: char ValueType: any str = 'an' cnt = Map with properties: Count: 31 KeyType: char ValueType: any cnt = Map with properties: Count: 31 KeyType: char ValueType: any str = 'ni' cnt = Map with properties: Count: 32 KeyType: char ValueType: any cnt = Map with properties: Count: 32 KeyType: char ValueType: any str = 'im' cnt = Map with properties: Count: 33 KeyType: char ValueType: any cnt = Map with properties: Count: 33 KeyType: char ValueType: any str = 'ma' cnt = Map with properties: Count: 33 KeyType: char ValueType: any str = 'al' cnt = Map with properties: Count: 34 KeyType: char ValueType: any cnt = Map with properties: Count: 34 KeyType: char ValueType: any str = 'l,' cnt = Map with properties: Count: 35 KeyType: char ValueType: any cnt = Map with properties: Count: 35 KeyType: char ValueType: any str = ', ' cnt = Map with properties: Count: 35 KeyType: char ValueType: any str = ' a' cnt = Map with properties: Count: 35 KeyType: char ValueType: any str = 'an' cnt = Map with properties: Count: 35 KeyType: char ValueType: any str = 'nd' cnt = Map with properties: Count: 36 KeyType: char ValueType: any cnt = Map with properties: Count: 36 KeyType: char ValueType: any str = 'd ' cnt = Map with properties: Count: 37 KeyType: char ValueType: any cnt = Map with properties: Count: 37 KeyType: char ValueType: any str = ' m' cnt = Map with properties: Count: 37 KeyType: char ValueType: any str = 'mi' cnt = Map with properties: Count: 38 KeyType: char ValueType: any cnt = Map with properties: Count: 38 KeyType: char ValueType: any str = 'in' cnt = Map with properties: Count: 38 KeyType: char ValueType: any str = 'ne' cnt = Map with properties: Count: 39 KeyType: char ValueType: any cnt = Map with properties: Count: 39 KeyType: char ValueType: any str = 'er' cnt = Map with properties: Count: 39 KeyType: char ValueType: any str = 'ra' cnt = Map with properties: Count: 40 KeyType: char ValueType: any cnt = Map with properties: Count: 40 KeyType: char ValueType: any str = 'al' cnt = Map with properties: Count: 40 KeyType: char ValueType: any str = 'l,' cnt = Map with properties: Count: 40 KeyType: char ValueType: any str = ', ' cnt = Map with properties: Count: 40 KeyType: char ValueType: any str = ' I' cnt = Map with properties: Count: 41 KeyType: char ValueType: any cnt = Map with properties: Count: 41 KeyType: char ValueType: any str = 'I ' cnt = Map with properties: Count: 42 KeyType: char ValueType: any cnt = Map with properties: Count: 42 KeyType: char ValueType: any str = ' a' cnt = Map with properties: Count: 42 KeyType: char ValueType: any str = 'am' cnt = Map with properties: Count: 43 KeyType: char ValueType: any cn...

Suggested Problems

More from this Author95

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!